Incidental Mutation 'R6880:Rab11fip5'
ID536612
Institutional Source Beutler Lab
Gene Symbol Rab11fip5
Ensembl Gene ENSMUSG00000051343
Gene NameRAB11 family interacting protein 5 (class I)
SynonymsRIP11, D6Ertd32e, GAF1, 9130206P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6880 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location85334962-85374634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85348845 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 193 (L193P)
Ref Sequence ENSEMBL: ENSMUSP00000145402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060837] [ENSMUST00000204087]
Predicted Effect probably damaging
Transcript: ENSMUST00000060837
AA Change: L193P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058305
Gene: ENSMUSG00000051343
AA Change: L193P

DomainStartEndE-ValueType
C2 20 143 8.7e-7 SMART
low complexity region 248 265 N/A INTRINSIC
low complexity region 313 322 N/A INTRINSIC
low complexity region 356 391 N/A INTRINSIC
Pfam:RBD-FIP 593 640 5.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204087
AA Change: L193P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145402
Gene: ENSMUSG00000051343
AA Change: L193P

DomainStartEndE-ValueType
C2 20 143 5.8e-9 SMART
low complexity region 248 265 N/A INTRINSIC
low complexity region 313 322 N/A INTRINSIC
low complexity region 356 391 N/A INTRINSIC
low complexity region 529 547 N/A INTRINSIC
low complexity region 560 568 N/A INTRINSIC
low complexity region 603 627 N/A INTRINSIC
low complexity region 687 692 N/A INTRINSIC
low complexity region 713 732 N/A INTRINSIC
low complexity region 852 887 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 1037 1052 N/A INTRINSIC
low complexity region 1068 1106 N/A INTRINSIC
low complexity region 1115 1149 N/A INTRINSIC
Pfam:RBD-FIP 1266 1313 8.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 97% (62/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a floxed allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T A 3: 36,069,705 probably null Het
Aff3 T C 1: 38,535,162 H206R probably damaging Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Alg5 A G 3: 54,738,843 E43G probably damaging Het
Ankrd36 T C 11: 5,628,748 L4P probably damaging Het
Ano1 T C 7: 144,644,742 Y345C probably benign Het
Atf7ip A G 6: 136,561,040 I432V probably damaging Het
B230307C23Rik T C 16: 97,997,427 probably benign Het
Baz2b T A 2: 59,912,939 N1563Y probably damaging Het
Bhlha15 A T 5: 144,191,633 T188S probably damaging Het
Cbr3 T C 16: 93,690,538 V203A probably benign Het
Cpsf1 T C 15: 76,602,539 T266A probably benign Het
Dnah7c T C 1: 46,527,671 Y681H probably damaging Het
Dock2 C T 11: 34,688,452 probably null Het
Dsc1 T A 18: 20,088,372 D682V probably damaging Het
Fkbp15 A T 4: 62,336,495 I256N possibly damaging Het
Foxd1 A C 13: 98,354,717 D33A unknown Het
Gid4 T A 11: 60,436,435 F149I probably damaging Het
Hmcn2 G T 2: 31,343,056 V206L probably damaging Het
Ighg2b T C 12: 113,307,106 I135V Het
Ighv1-24 T C 12: 114,773,043 Y79C possibly damaging Het
Impg1 T A 9: 80,404,800 D167V probably damaging Het
Jakmip1 T C 5: 37,105,623 S372P possibly damaging Het
Kcnb1 T C 2: 167,105,807 T374A probably damaging Het
Lrrn4 A G 2: 132,872,112 S305P probably damaging Het
Ltbp1 C T 17: 75,321,049 T1179I possibly damaging Het
Mab21l2 A G 3: 86,547,156 I179T possibly damaging Het
Myo5b A T 18: 74,722,430 H1230L probably benign Het
Myocos T C 1: 162,657,033 probably null Het
Nipa2 T C 7: 55,933,251 T249A probably damaging Het
Oas1a C A 5: 120,901,940 R196L probably damaging Het
Olfr228 A G 2: 86,483,725 F6L probably benign Het
Olfr235 A G 19: 12,268,610 I127V probably benign Het
Olfr700 A T 7: 106,805,812 S217T probably damaging Het
Phxr2 G A 10: 99,126,084 probably benign Het
Pigq A G 17: 25,934,828 L85P probably damaging Het
Pla2g4a T A 1: 149,851,451 D518V possibly damaging Het
Pm20d1 A G 1: 131,804,101 K294E probably benign Het
Polr3d C A 14: 70,440,015 R307L probably benign Het
Pou5f2 T C 13: 78,025,494 L185P possibly damaging Het
Prex2 A T 1: 11,132,384 N506Y probably damaging Het
Proser1 T A 3: 53,477,839 S381T probably benign Het
Prpf4b T C 13: 34,894,453 V682A possibly damaging Het
Prr14l A T 5: 32,830,867 L428Q probably benign Het
Prss23 A G 7: 89,510,825 V12A probably benign Het
Qk T C 17: 10,215,447 D321G probably benign Het
Retreg1 T G 15: 25,971,739 L245R probably damaging Het
Rfc1 T C 5: 65,277,386 N679S probably benign Het
Rpl4 C T 9: 64,177,053 A220V probably damaging Het
Rxra G A 2: 27,748,656 E224K possibly damaging Het
Slc26a7 A G 4: 14,516,159 C557R possibly damaging Het
Sncaip A G 18: 52,869,064 K219R probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sphkap A G 1: 83,257,257 V1616A probably damaging Het
Sulf1 T C 1: 12,842,755 C738R probably damaging Het
Suz12 T A 11: 80,002,172 C38* probably null Het
Ttn T C 2: 76,720,498 T23190A probably damaging Het
Twnk A G 19: 45,007,416 D96G probably benign Het
Vcan T A 13: 89,712,381 N289I probably damaging Het
Vmn2r120 A T 17: 57,509,187 S723T probably damaging Het
Vmn2r97 A T 17: 18,914,508 I63F probably benign Het
Washc5 T C 15: 59,350,172 N125S probably benign Het
Zfp865 A G 7: 5,030,549 Y511C probably damaging Het
Other mutations in Rab11fip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Rab11fip5 APN 6 85337552 missense probably damaging 1.00
IGL02471:Rab11fip5 APN 6 85348225 missense probably damaging 0.99
IGL02725:Rab11fip5 APN 6 85374489 missense probably damaging 0.99
IGL02737:Rab11fip5 APN 6 85348558 missense probably damaging 1.00
PIT4812001:Rab11fip5 UTSW 6 85341558 missense probably benign 0.38
R0627:Rab11fip5 UTSW 6 85348051 missense probably benign 0.05
R1652:Rab11fip5 UTSW 6 85348297 missense probably damaging 0.97
R1961:Rab11fip5 UTSW 6 85348991 missense possibly damaging 0.87
R2106:Rab11fip5 UTSW 6 85374387 missense probably damaging 0.98
R2142:Rab11fip5 UTSW 6 85337228 critical splice acceptor site probably null
R4729:Rab11fip5 UTSW 6 85374267 missense probably damaging 0.99
R5001:Rab11fip5 UTSW 6 85347806 missense probably damaging 1.00
R5116:Rab11fip5 UTSW 6 85348807 missense probably damaging 1.00
R5506:Rab11fip5 UTSW 6 85374137 missense probably damaging 1.00
R5801:Rab11fip5 UTSW 6 85337600 missense probably damaging 0.99
R6338:Rab11fip5 UTSW 6 85341378 missense possibly damaging 0.94
R6696:Rab11fip5 UTSW 6 85341946 missense possibly damaging 0.65
R6763:Rab11fip5 UTSW 6 85342170 missense probably benign 0.02
R6932:Rab11fip5 UTSW 6 85341558 missense probably benign 0.38
R7042:Rab11fip5 UTSW 6 85374128 missense possibly damaging 0.82
R7112:Rab11fip5 UTSW 6 85348194 missense probably damaging 1.00
R7197:Rab11fip5 UTSW 6 85342155 missense probably damaging 1.00
R7384:Rab11fip5 UTSW 6 85348330 missense possibly damaging 0.47
R7395:Rab11fip5 UTSW 6 85341868 missense probably benign
R7451:Rab11fip5 UTSW 6 85341556 missense probably benign 0.06
R7482:Rab11fip5 UTSW 6 85340778 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TAGACTGTGTGAGCGAGGAC -3'
(R):5'- TCCAAAACCCAAGCTCGTGTG -3'

Sequencing Primer
(F):5'- TGAGCGAGGACTTGCGTAG -3'
(R):5'- TTCTGAGGCGCCTGTGAC -3'
Posted On2018-10-18