Incidental Mutation 'R6881:Pld1'
ID536652
Institutional Source Beutler Lab
Gene Symbol Pld1
Ensembl Gene ENSMUSG00000027695
Gene Namephospholipase D1
SynonymsPld1a, Pld1b
MMRRC Submission
Accession Numbers

Genbank: NM_001164056; MGI: 109585

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6881 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location27938695-28133362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28078414 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 584 (S584P)
Ref Sequence ENSEMBL: ENSMUSP00000113810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067757] [ENSMUST00000120834] [ENSMUST00000123539]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067757
AA Change: S584P

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000064694
Gene: ENSMUSG00000027695
AA Change: S584P

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120834
AA Change: S584P

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113810
Gene: ENSMUSG00000027695
AA Change: S584P

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123539
AA Change: S584P

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118727
Gene: ENSMUSG00000027695
AA Change: S584P

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 586 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000120273
Gene: ENSMUSG00000027695
AA Change: S395P

DomainStartEndE-ValueType
PH 32 142 5.71e-9 SMART
PLDc 271 298 6.6e-6 SMART
low complexity region 315 329 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
PLDc 665 715 2.5e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylcholine-specific phospholipase which catalyzes the hydrolysis of phosphatidylcholine in order to yield phosphatidic acid and choline. The enzyme may play a role in signal transduction and subcellular trafficking. Alternative splicing results in multiple transcript variants with both catalytic and regulatory properties. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a null allele show reduced tumor growth and angiogenesis. Homozygotes for a second null allele show abnormal hepatic autophagy after food restriction. Homozygotes for a third null allele show altered platelet activation and protection from thrombosis and ischemic brain injury. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009C09Rik C A 15: 82,259,585 H3N possibly damaging Het
4931406C07Rik A C 9: 15,290,765 C187G possibly damaging Het
Abhd16a C T 17: 35,096,601 T208I probably benign Het
Ahcyl1 A T 3: 107,668,109 H425Q probably damaging Het
Ankrd22 T A 19: 34,149,382 N16I probably damaging Het
Cc2d2b A G 19: 40,825,039 E1321G probably damaging Het
Ccdc7b A G 8: 129,072,547 E35G probably damaging Het
Chsy3 A G 18: 59,179,408 I318V probably damaging Het
Clrn2 G A 5: 45,453,822 W4* probably null Het
Cmip T C 8: 117,436,595 I355T possibly damaging Het
Cmya5 C T 13: 93,090,292 V2763M probably damaging Het
Cnnm2 T C 19: 46,877,219 S749P probably damaging Het
Cyp1a1 G T 9: 57,700,719 R210L possibly damaging Het
Dmxl1 G A 18: 49,935,305 S2715N probably benign Het
Dync1h1 T C 12: 110,624,561 L1021P probably damaging Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Galnt11 G T 5: 25,250,099 K144N possibly damaging Het
Gm45861 A G 8: 27,535,251 probably null Het
Kcnk18 T A 19: 59,219,958 D75E probably benign Het
Kcnk2 C T 1: 189,209,990 V346M probably benign Het
Klhl33 T A 14: 50,891,472 M767L probably benign Het
Knl1 T C 2: 119,095,184 I1898T possibly damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lamp3 T C 16: 19,699,618 T290A probably benign Het
Larp1 T A 11: 58,050,023 D658E probably damaging Het
Macf1 T A 4: 123,432,453 I3521F probably damaging Het
Med12l T C 3: 59,267,165 S1835P probably benign Het
Mef2c C A 13: 83,592,942 N73K probably damaging Het
Mtmr3 T C 11: 4,489,725 S572G probably benign Het
Neto2 A T 8: 85,640,556 S520T probably damaging Het
Olfr1215 A T 2: 89,001,937 M117K probably damaging Het
Olfr1330 A G 4: 118,893,107 N8S probably damaging Het
Olfr99 A G 17: 37,280,309 L37S probably benign Het
P3h2 G A 16: 25,992,745 R243C probably damaging Het
Papd5 T C 8: 88,250,788 V363A possibly damaging Het
Prkcz T C 4: 155,269,056 N278S possibly damaging Het
Radil A G 5: 142,486,917 S913P probably benign Het
Retreg2 A C 1: 75,146,439 Q337P probably damaging Het
Sh3gl3 A G 7: 82,306,970 E305G possibly damaging Het
Shank1 G T 7: 44,351,793 D979Y unknown Het
Slc35a5 A T 16: 45,144,080 N263K possibly damaging Het
Slc4a7 A T 14: 14,737,452 M127L probably benign Het
Slc8a2 G A 7: 16,157,357 G774E probably damaging Het
Snap91 A G 9: 86,773,593 S847P possibly damaging Het
Stoml1 T C 9: 58,260,894 L296P probably damaging Het
Tap1 G T 17: 34,188,034 G52V probably damaging Het
Tnfrsf11b T C 15: 54,254,143 R239G probably benign Het
Ttn T C 2: 76,706,502 Y34993C probably damaging Het
Uchl1 T C 5: 66,683,722 F165L probably damaging Het
Xrcc1 C T 7: 24,547,351 Q15* probably null Het
Zkscan7 C G 9: 122,888,701 Q54E possibly damaging Het
Other mutations in Pld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Pld1 APN 3 28045098 critical splice donor site probably null
IGL01090:Pld1 APN 3 28088667 missense probably benign 0.01
IGL01140:Pld1 APN 3 28078237 missense probably benign 0.01
IGL01646:Pld1 APN 3 28099664 missense probably damaging 1.00
IGL01830:Pld1 APN 3 28048004 splice site probably benign
IGL01946:Pld1 APN 3 28124617 missense probably damaging 1.00
IGL02139:Pld1 APN 3 28120812 missense probably damaging 0.98
IGL02189:Pld1 APN 3 28120783 missense probably benign 0.03
IGL02476:Pld1 APN 3 28048039 missense probably damaging 1.00
IGL02540:Pld1 APN 3 28029160 unclassified probably benign
IGL02649:Pld1 APN 3 28087229 missense probably damaging 0.98
IGL02720:Pld1 APN 3 28087262 missense probably damaging 1.00
IGL02831:Pld1 APN 3 28076425 missense probably damaging 0.99
IGL02953:Pld1 APN 3 28112247 missense probably benign 0.03
IGL03005:Pld1 APN 3 28087253 missense possibly damaging 0.78
IGL03251:Pld1 APN 3 28088665 missense probably benign 0.06
IGL03331:Pld1 APN 3 28085845 missense probably damaging 1.00
A9681:Pld1 UTSW 3 28085832 missense probably benign 0.01
IGL03134:Pld1 UTSW 3 28029167 missense probably benign 0.01
P0023:Pld1 UTSW 3 28048125 missense probably damaging 1.00
R0054:Pld1 UTSW 3 28095884 splice site probably benign
R0054:Pld1 UTSW 3 28095884 splice site probably benign
R0282:Pld1 UTSW 3 28078273 missense probably benign
R0372:Pld1 UTSW 3 28088638 splice site probably null
R0454:Pld1 UTSW 3 28124575 missense probably damaging 1.00
R0492:Pld1 UTSW 3 28109817 missense probably damaging 0.96
R0505:Pld1 UTSW 3 28120822 missense possibly damaging 0.69
R0667:Pld1 UTSW 3 28079178 splice site probably null
R0678:Pld1 UTSW 3 28120784 missense probably damaging 0.99
R0980:Pld1 UTSW 3 28124575 missense probably damaging 1.00
R1200:Pld1 UTSW 3 28049286 missense probably damaging 1.00
R1235:Pld1 UTSW 3 28028734 missense probably benign 0.05
R1657:Pld1 UTSW 3 28071187 missense probably benign 0.04
R1670:Pld1 UTSW 3 28049240 missense probably benign 0.17
R1705:Pld1 UTSW 3 28071277 critical splice donor site probably null
R1815:Pld1 UTSW 3 28109768 missense probably benign 0.04
R2215:Pld1 UTSW 3 28078393 missense probably benign 0.16
R3435:Pld1 UTSW 3 28124623 missense probably benign 0.13
R3522:Pld1 UTSW 3 28031247 missense probably damaging 1.00
R4206:Pld1 UTSW 3 28120783 missense probably benign 0.03
R4553:Pld1 UTSW 3 28124702 missense probably benign
R4612:Pld1 UTSW 3 28131733 missense possibly damaging 0.92
R4623:Pld1 UTSW 3 28029244 missense probably benign 0.01
R4840:Pld1 UTSW 3 28076551 missense probably benign 0.10
R4869:Pld1 UTSW 3 28109802 missense possibly damaging 0.84
R4982:Pld1 UTSW 3 28031298 missense probably damaging 0.97
R5087:Pld1 UTSW 3 28124582 missense probably damaging 1.00
R5182:Pld1 UTSW 3 28045081 missense probably damaging 1.00
R5384:Pld1 UTSW 3 28025320 missense probably damaging 1.00
R6243:Pld1 UTSW 3 28095805 missense probably damaging 0.98
R6345:Pld1 UTSW 3 28130747 intron probably benign
R6692:Pld1 UTSW 3 28041199 missense probably benign 0.15
R7197:Pld1 UTSW 3 28024252 missense probably damaging 1.00
R7267:Pld1 UTSW 3 28076401 missense probably damaging 1.00
R7284:Pld1 UTSW 3 28131733 missense possibly damaging 0.92
R7293:Pld1 UTSW 3 28087286 missense probably damaging 0.99
R7440:Pld1 UTSW 3 28041270 missense probably benign 0.01
R7524:Pld1 UTSW 3 28024321 missense possibly damaging 0.77
Z1088:Pld1 UTSW 3 28029243 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGAATCCTTAAGCCTCAAGG -3'
(R):5'- GCCATCAAAAGTATCAACAGTGG -3'

Sequencing Primer
(F):5'- TCCTTAAGCCTCAAGGATAAACATG -3'
(R):5'- CCCAATAGGTAGAGTGCTTGC -3'
Posted On2018-10-18