Incidental Mutation 'R6881:Neto2'
ID536667
Institutional Source Beutler Lab
Gene Symbol Neto2
Ensembl Gene ENSMUSG00000036902
Gene Nameneuropilin (NRP) and tolloid (TLL)-like 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R6881 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location85636588-85700924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85640556 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 520 (S520T)
Ref Sequence ENSEMBL: ENSMUSP00000150062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]
Predicted Effect probably damaging
Transcript: ENSMUST00000109686
AA Change: S548T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: S548T

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
CUB 80 194 2.56e-40 SMART
CUB 205 320 9.11e-5 SMART
LDLa 324 361 5.73e-5 SMART
transmembrane domain 374 396 N/A INTRINSIC
coiled coil region 432 460 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209479
AA Change: S513T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000216286
AA Change: S520T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009C09Rik C A 15: 82,259,585 H3N possibly damaging Het
4931406C07Rik A C 9: 15,290,765 C187G possibly damaging Het
Abhd16a C T 17: 35,096,601 T208I probably benign Het
Ahcyl1 A T 3: 107,668,109 H425Q probably damaging Het
Ankrd22 T A 19: 34,149,382 N16I probably damaging Het
Cc2d2b A G 19: 40,825,039 E1321G probably damaging Het
Ccdc7b A G 8: 129,072,547 E35G probably damaging Het
Chsy3 A G 18: 59,179,408 I318V probably damaging Het
Clrn2 G A 5: 45,453,822 W4* probably null Het
Cmip T C 8: 117,436,595 I355T possibly damaging Het
Cmya5 C T 13: 93,090,292 V2763M probably damaging Het
Cnnm2 T C 19: 46,877,219 S749P probably damaging Het
Cyp1a1 G T 9: 57,700,719 R210L possibly damaging Het
Dmxl1 G A 18: 49,935,305 S2715N probably benign Het
Dync1h1 T C 12: 110,624,561 L1021P probably damaging Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Galnt11 G T 5: 25,250,099 K144N possibly damaging Het
Gm45861 A G 8: 27,535,251 probably null Het
Kcnk18 T A 19: 59,219,958 D75E probably benign Het
Kcnk2 C T 1: 189,209,990 V346M probably benign Het
Klhl33 T A 14: 50,891,472 M767L probably benign Het
Knl1 T C 2: 119,095,184 I1898T possibly damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lamp3 T C 16: 19,699,618 T290A probably benign Het
Larp1 T A 11: 58,050,023 D658E probably damaging Het
Macf1 T A 4: 123,432,453 I3521F probably damaging Het
Med12l T C 3: 59,267,165 S1835P probably benign Het
Mef2c C A 13: 83,592,942 N73K probably damaging Het
Mtmr3 T C 11: 4,489,725 S572G probably benign Het
Olfr1215 A T 2: 89,001,937 M117K probably damaging Het
Olfr1330 A G 4: 118,893,107 N8S probably damaging Het
Olfr99 A G 17: 37,280,309 L37S probably benign Het
P3h2 G A 16: 25,992,745 R243C probably damaging Het
Papd5 T C 8: 88,250,788 V363A possibly damaging Het
Pld1 T C 3: 28,078,414 S584P possibly damaging Het
Prkcz T C 4: 155,269,056 N278S possibly damaging Het
Radil A G 5: 142,486,917 S913P probably benign Het
Retreg2 A C 1: 75,146,439 Q337P probably damaging Het
Sh3gl3 A G 7: 82,306,970 E305G possibly damaging Het
Shank1 G T 7: 44,351,793 D979Y unknown Het
Slc35a5 A T 16: 45,144,080 N263K possibly damaging Het
Slc4a7 A T 14: 14,737,452 M127L probably benign Het
Slc8a2 G A 7: 16,157,357 G774E probably damaging Het
Snap91 A G 9: 86,773,593 S847P possibly damaging Het
Stoml1 T C 9: 58,260,894 L296P probably damaging Het
Tap1 G T 17: 34,188,034 G52V probably damaging Het
Tnfrsf11b T C 15: 54,254,143 R239G probably benign Het
Ttn T C 2: 76,706,502 Y34993C probably damaging Het
Uchl1 T C 5: 66,683,722 F165L probably damaging Het
Xrcc1 C T 7: 24,547,351 Q15* probably null Het
Zkscan7 C G 9: 122,888,701 Q54E possibly damaging Het
Other mutations in Neto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Neto2 APN 8 85641003 missense probably damaging 1.00
IGL01938:Neto2 APN 8 85690855 missense probably benign 0.00
IGL02238:Neto2 APN 8 85669663 missense probably damaging 0.99
IGL02605:Neto2 APN 8 85663435 splice site probably benign
IGL02813:Neto2 APN 8 85690886 missense probably benign
R0138:Neto2 UTSW 8 85641044 missense possibly damaging 0.72
R1934:Neto2 UTSW 8 85670404 missense possibly damaging 0.96
R2402:Neto2 UTSW 8 85690912 missense probably benign 0.00
R2423:Neto2 UTSW 8 85669767 missense probably damaging 1.00
R3821:Neto2 UTSW 8 85663295 nonsense probably null
R3822:Neto2 UTSW 8 85663295 nonsense probably null
R3883:Neto2 UTSW 8 85663265 missense probably damaging 1.00
R3939:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R3940:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R3941:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R4433:Neto2 UTSW 8 85641083 missense probably damaging 1.00
R4668:Neto2 UTSW 8 85641062 missense probably damaging 1.00
R4675:Neto2 UTSW 8 85669704 missense probably damaging 1.00
R4908:Neto2 UTSW 8 85669764 missense probably damaging 0.99
R5459:Neto2 UTSW 8 85670483 missense probably benign 0.35
R5471:Neto2 UTSW 8 85640760 missense probably benign 0.41
R5544:Neto2 UTSW 8 85647877 missense possibly damaging 0.94
R5571:Neto2 UTSW 8 85640544 missense probably damaging 1.00
R6083:Neto2 UTSW 8 85640585 missense probably benign 0.00
R6339:Neto2 UTSW 8 85640558 missense probably benign 0.33
R6381:Neto2 UTSW 8 85642509 missense probably damaging 0.99
R6572:Neto2 UTSW 8 85670404 missense possibly damaging 0.96
R6593:Neto2 UTSW 8 85669546 missense probably damaging 1.00
R6662:Neto2 UTSW 8 85663215 missense probably damaging 1.00
R6950:Neto2 UTSW 8 85670443 missense probably damaging 1.00
R7121:Neto2 UTSW 8 85670391 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCAACAGATGATGCCTTCTTTC -3'
(R):5'- TGATTTTGCACAACCACAGCC -3'

Sequencing Primer
(F):5'- AACAGATGATGCCTTCTTTCCACTG -3'
(R):5'- GCCAATGAAAACATTTAATAGCACC -3'
Posted On2018-10-18