Incidental Mutation 'R6881:1500009C09Rik'
List |< first << previous [record 11 of 18487] next >> last >|
ID536685
Institutional Source Beutler Lab
Gene Symbol 1500009C09Rik
Ensembl Gene ENSMUSG00000068099
Gene NameRIKEN cDNA 1500009C09 gene
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6881 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location82252397-82260753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 82259585 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 3 (H3N)
Ref Sequence ENSEMBL: ENSMUSP00000120070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136948] [ENSMUST00000143238]
Predicted Effect possibly damaging
Transcript: ENSMUST00000136948
AA Change: H16N

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115748
Gene: ENSMUSG00000068099
AA Change: H16N

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143238
AA Change: H3N

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120070
Gene: ENSMUSG00000068099
AA Change: H3N

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A C 9: 15,290,765 C187G possibly damaging Het
Abhd16a C T 17: 35,096,601 T208I probably benign Het
Ahcyl1 A T 3: 107,668,109 H425Q probably damaging Het
Ankrd22 T A 19: 34,149,382 N16I probably damaging Het
Cc2d2b A G 19: 40,825,039 E1321G probably damaging Het
Ccdc7b A G 8: 129,072,547 E35G probably damaging Het
Chsy3 A G 18: 59,179,408 I318V probably damaging Het
Clrn2 G A 5: 45,453,822 W4* probably null Het
Cmip T C 8: 117,436,595 I355T possibly damaging Het
Cmya5 C T 13: 93,090,292 V2763M probably damaging Het
Cnnm2 T C 19: 46,877,219 S749P probably damaging Het
Cyp1a1 G T 9: 57,700,719 R210L possibly damaging Het
Dmxl1 G A 18: 49,935,305 S2715N probably benign Het
Dync1h1 T C 12: 110,624,561 L1021P probably damaging Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Galnt11 G T 5: 25,250,099 K144N possibly damaging Het
Gm45861 A G 8: 27,535,251 probably null Het
Kcnk18 T A 19: 59,219,958 D75E probably benign Het
Kcnk2 C T 1: 189,209,990 V346M probably benign Het
Klhl33 T A 14: 50,891,472 M767L probably benign Het
Knl1 T C 2: 119,095,184 I1898T possibly damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lamp3 T C 16: 19,699,618 T290A probably benign Het
Larp1 T A 11: 58,050,023 D658E probably damaging Het
Macf1 T A 4: 123,432,453 I3521F probably damaging Het
Med12l T C 3: 59,267,165 S1835P probably benign Het
Mef2c C A 13: 83,592,942 N73K probably damaging Het
Mtmr3 T C 11: 4,489,725 S572G probably benign Het
Neto2 A T 8: 85,640,556 S520T probably damaging Het
Olfr1215 A T 2: 89,001,937 M117K probably damaging Het
Olfr1330 A G 4: 118,893,107 N8S probably damaging Het
Olfr99 A G 17: 37,280,309 L37S probably benign Het
P3h2 G A 16: 25,992,745 R243C probably damaging Het
Papd5 T C 8: 88,250,788 V363A possibly damaging Het
Pld1 T C 3: 28,078,414 S584P possibly damaging Het
Prkcz T C 4: 155,269,056 N278S possibly damaging Het
Radil A G 5: 142,486,917 S913P probably benign Het
Retreg2 A C 1: 75,146,439 Q337P probably damaging Het
Sh3gl3 A G 7: 82,306,970 E305G possibly damaging Het
Shank1 G T 7: 44,351,793 D979Y unknown Het
Slc35a5 A T 16: 45,144,080 N263K possibly damaging Het
Slc4a7 A T 14: 14,737,452 M127L probably benign Het
Slc8a2 G A 7: 16,157,357 G774E probably damaging Het
Snap91 A G 9: 86,773,593 S847P possibly damaging Het
Stoml1 T C 9: 58,260,894 L296P probably damaging Het
Tap1 G T 17: 34,188,034 G52V probably damaging Het
Tnfrsf11b T C 15: 54,254,143 R239G probably benign Het
Ttn T C 2: 76,706,502 Y34993C probably damaging Het
Uchl1 T C 5: 66,683,722 F165L probably damaging Het
Xrcc1 C T 7: 24,547,351 Q15* probably null Het
Zkscan7 C G 9: 122,888,701 Q54E possibly damaging Het
Predicted Primers PCR Primer
(F):5'- ATGAGTAGGAACTGAGTGTCCTC -3'
(R):5'- AGGTTGTCCCGCATCATCAG -3'

Sequencing Primer
(F):5'- AACTGAGTGTCCTCGTGAAG -3'
(R):5'- GCGTCTTGCGGAGATCAC -3'
Posted On2018-10-18