Incidental Mutation 'R6882:Col6a5'
ID536731
Institutional Source Beutler Lab
Gene Symbol Col6a5
Ensembl Gene ENSMUSG00000091345
Gene Namecollagen, type VI, alpha 5
SynonymsGm7455, Col6a5
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R6882 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location105856078-105960643 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 105940270 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 281 (Q281*)
Ref Sequence ENSEMBL: ENSMUSP00000139398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165165] [ENSMUST00000190193]
Predicted Effect probably null
Transcript: ENSMUST00000165165
AA Change: Q281*
SMART Domains Protein: ENSMUSP00000131146
Gene: ENSMUSG00000091345
AA Change: Q281*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.8e-24 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 2.23e-20 SMART
VWA 472 649 6.84e-39 SMART
VWA 658 834 1.52e-45 SMART
VWA 844 1024 2.44e-44 SMART
VWA 1035 1208 2.95e-20 SMART
Pfam:Collagen 1425 1478 3.3e-8 PFAM
low complexity region 1493 1508 N/A INTRINSIC
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 9.6e-10 PFAM
low complexity region 1711 1730 N/A INTRINSIC
low complexity region 1739 1757 N/A INTRINSIC
VWA 1788 1964 1.99e-17 SMART
VWA 1994 2173 5.98e-21 SMART
VWA 2319 2513 4.4e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190193
AA Change: Q281*
SMART Domains Protein: ENSMUSP00000139398
Gene: ENSMUSG00000091345
AA Change: Q281*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.1e-26 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 1.4e-22 SMART
VWA 472 649 4.4e-41 SMART
VWA 658 834 9.5e-48 SMART
VWA 844 1024 1.6e-46 SMART
VWA 1035 1208 1.9e-22 SMART
Pfam:Collagen 1425 1478 1.2e-6 PFAM
Pfam:Collagen 1457 1530 5.9e-6 PFAM
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 3.6e-8 PFAM
Pfam:Collagen 1631 1691 8.4e-6 PFAM
Pfam:Collagen 1706 1764 6.6e-6 PFAM
VWA 1788 1964 1.2e-19 SMART
VWA 1994 2173 3.7e-23 SMART
VWA 2319 2513 2.8e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the collagen superfamily of proteins. The encoded protein contains multiple von Willebrand factor A-like domains and may interact with the alpha 1 and alpha 2 chains of collagen VI to form the complete collagen VI trimer. Polymorphisms in this gene may be linked to dermal phenotypes, such as eczema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr10 A G 12: 70,956,351 E238G probably benign Het
Adgrf5 T A 17: 43,450,380 C989S probably damaging Het
Ank2 T G 3: 126,945,757 probably benign Het
C2cd6 T C 1: 59,066,159 D320G probably damaging Het
Cacnb2 T A 2: 14,824,299 I15N probably benign Het
Cage1 T A 13: 38,022,558 Q437L probably damaging Het
Capn15 G T 17: 25,960,179 probably null Het
Cbll1 A G 12: 31,487,485 Y424H probably damaging Het
Cdkl4 T A 17: 80,543,746 T176S probably damaging Het
Cnot1 T C 8: 95,720,426 E2321G possibly damaging Het
Csmd2 A G 4: 128,449,269 T1485A probably benign Het
Dmxl1 A G 18: 49,843,784 probably null Het
Dnah3 A G 7: 119,971,184 I2271T possibly damaging Het
Elavl2 A G 4: 91,308,715 I42T probably damaging Het
Epn3 C T 11: 94,491,360 A568T probably benign Het
Etv3 T C 3: 87,529,270 F111L probably damaging Het
Fnip1 A G 11: 54,509,898 E1041G probably damaging Het
Fosl2 T C 5: 32,152,864 V219A possibly damaging Het
Foxj2 T A 6: 122,828,505 probably null Het
Gm8947 G A 1: 151,193,129 A238T possibly damaging Het
Golgb1 C A 16: 36,913,990 Q1200K probably benign Het
Igkv4-55 A G 6: 69,607,305 Y108H probably damaging Het
Iglc1 G A 16: 19,061,849 probably benign Het
Ints13 G T 6: 146,563,441 R221S probably null Het
Ipo11 T C 13: 106,900,682 probably null Het
Kcnn2 A T 18: 45,559,438 H27L possibly damaging Het
Kcns3 C T 12: 11,092,048 V217M probably benign Het
Klra9 A T 6: 130,179,022 C257S probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lmbr1l A G 15: 98,907,586 F345L probably damaging Het
Lrrc18 A C 14: 33,008,689 I62L probably benign Het
Mr1 A G 1: 155,132,453 W259R possibly damaging Het
Myo15 G A 11: 60,524,006 R3325H probably damaging Het
Nid2 A G 14: 19,789,707 D788G probably damaging Het
Olfr1386 A T 11: 49,470,463 Y104F probably benign Het
Olfr1436 C A 19: 12,298,570 Q187H probably damaging Het
Olfr192 A T 16: 59,098,627 C122S unknown Het
Olfr212 T C 6: 116,516,434 V219A probably benign Het
Pbld1 T C 10: 63,061,462 L11P probably benign Het
Pcnt T C 10: 76,427,828 E434G probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Prg4 G A 1: 150,453,495 T174M probably damaging Het
Prkdc G A 16: 15,783,263 probably null Het
Prkdc T A 16: 15,808,156 S3349T probably benign Het
Prpf38a C A 4: 108,570,168 E199D probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Rhbg T A 3: 88,245,220 H339L probably damaging Het
Rnf183 A G 4: 62,428,024 I179T probably benign Het
Sh3bp5l G T 11: 58,331,699 A7S probably benign Het
Slc12a3 T A 8: 94,365,918 I989N possibly damaging Het
Sycp3 C T 10: 88,472,929 R246* probably null Het
Tmprss11b T A 5: 86,671,671 probably null Het
Tmx4 T C 2: 134,644,002 T2A possibly damaging Het
Tnfsf10 T C 3: 27,326,033 L82S possibly damaging Het
Tnni3k T A 3: 154,957,720 I332F possibly damaging Het
Ttn T A 2: 76,814,195 T13072S probably benign Het
Vmn2r1 A T 3: 64,090,108 Y395F possibly damaging Het
Zbbx A G 3: 75,071,712 V476A probably benign Het
Zfp341 T C 2: 154,638,023 C465R probably damaging Het
Zfp398 A G 6: 47,866,082 D224G probably damaging Het
Zfp407 G T 18: 84,343,069 probably null Het
Zfp52 T C 17: 21,555,047 M1T probably null Het
Other mutations in Col6a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Col6a5 APN 9 105882683 missense probably damaging 1.00
IGL01462:Col6a5 APN 9 105946075 missense unknown
IGL01530:Col6a5 APN 9 105915186 splice site probably benign
IGL01717:Col6a5 APN 9 105940273 missense unknown
IGL01859:Col6a5 APN 9 105930961 nonsense probably null
IGL01945:Col6a5 APN 9 105928290 missense unknown
IGL01985:Col6a5 APN 9 105937283 missense unknown
IGL02128:Col6a5 APN 9 105939894 missense unknown
IGL02170:Col6a5 APN 9 105928422 missense unknown
IGL02224:Col6a5 APN 9 105864335 missense probably damaging 1.00
IGL02246:Col6a5 APN 9 105911107 nonsense probably null
IGL02304:Col6a5 APN 9 105928414 missense unknown
IGL02338:Col6a5 APN 9 105878630 missense probably damaging 1.00
IGL02375:Col6a5 APN 9 105906113 missense unknown
IGL02660:Col6a5 APN 9 105936886 missense unknown
IGL02829:Col6a5 APN 9 105934307 missense unknown
IGL02882:Col6a5 APN 9 105934321 missense unknown
IGL02973:Col6a5 APN 9 105925821 missense unknown
IGL03089:Col6a5 APN 9 105933839 missense unknown
IGL03100:Col6a5 APN 9 105937313 missense unknown
IGL03257:Col6a5 APN 9 105881873 missense possibly damaging 0.95
FR4340:Col6a5 UTSW 9 105934174 missense unknown
FR4342:Col6a5 UTSW 9 105934174 missense unknown
FR4589:Col6a5 UTSW 9 105934174 missense unknown
PIT4131001:Col6a5 UTSW 9 105881914 missense probably damaging 0.98
R0147:Col6a5 UTSW 9 105925794 missense unknown
R0549:Col6a5 UTSW 9 105904579 splice site probably benign
R0622:Col6a5 UTSW 9 105925852 missense unknown
R0628:Col6a5 UTSW 9 105912450 splice site probably null
R0635:Col6a5 UTSW 9 105928606 missense unknown
R0644:Col6a5 UTSW 9 105948324 critical splice donor site probably null
R0828:Col6a5 UTSW 9 105862064 critical splice acceptor site probably null
R0972:Col6a5 UTSW 9 105940285 missense unknown
R1065:Col6a5 UTSW 9 105881783 missense probably damaging 0.99
R1142:Col6a5 UTSW 9 105934317 missense unknown
R1169:Col6a5 UTSW 9 105896974 splice site probably null
R1522:Col6a5 UTSW 9 105939994 missense unknown
R1646:Col6a5 UTSW 9 105862749 nonsense probably null
R1719:Col6a5 UTSW 9 105931293 missense unknown
R1759:Col6a5 UTSW 9 105930846 missense unknown
R1780:Col6a5 UTSW 9 105936878 missense unknown
R1812:Col6a5 UTSW 9 105928054 missense unknown
R1838:Col6a5 UTSW 9 105864833 missense probably benign 0.28
R1839:Col6a5 UTSW 9 105864833 missense probably benign 0.28
R1863:Col6a5 UTSW 9 105940201 missense unknown
R1900:Col6a5 UTSW 9 105931213 missense unknown
R1951:Col6a5 UTSW 9 105936957 missense unknown
R2024:Col6a5 UTSW 9 105936994 missense unknown
R2126:Col6a5 UTSW 9 105945600 missense unknown
R2319:Col6a5 UTSW 9 105937218 missense unknown
R2344:Col6a5 UTSW 9 105928537 missense unknown
R2483:Col6a5 UTSW 9 105864148 missense probably damaging 1.00
R3176:Col6a5 UTSW 9 105911107 nonsense probably null
R3276:Col6a5 UTSW 9 105911107 nonsense probably null
R3438:Col6a5 UTSW 9 105875792 missense possibly damaging 0.88
R3791:Col6a5 UTSW 9 105864669 missense probably damaging 0.99
R3840:Col6a5 UTSW 9 105928611 missense unknown
R3886:Col6a5 UTSW 9 105930930 missense unknown
R3941:Col6a5 UTSW 9 105939834 missense unknown
R4194:Col6a5 UTSW 9 105945914 missense unknown
R4399:Col6a5 UTSW 9 105888965 missense possibly damaging 0.75
R4421:Col6a5 UTSW 9 105928473 missense unknown
R4450:Col6a5 UTSW 9 105904521 missense unknown
R4491:Col6a5 UTSW 9 105940012 missense unknown
R4582:Col6a5 UTSW 9 105862764 missense probably benign 0.17
R4693:Col6a5 UTSW 9 105937172 missense unknown
R4787:Col6a5 UTSW 9 105931081 missense unknown
R4789:Col6a5 UTSW 9 105937335 missense unknown
R4791:Col6a5 UTSW 9 105930784 missense unknown
R4792:Col6a5 UTSW 9 105930784 missense unknown
R4817:Col6a5 UTSW 9 105934298 missense unknown
R4854:Col6a5 UTSW 9 105898751 missense probably benign 0.18
R4927:Col6a5 UTSW 9 105933964 missense unknown
R4969:Col6a5 UTSW 9 105864607 missense probably damaging 1.00
R5037:Col6a5 UTSW 9 105928138 missense unknown
R5118:Col6a5 UTSW 9 105937005 missense unknown
R5144:Col6a5 UTSW 9 105889283 missense probably damaging 1.00
R5145:Col6a5 UTSW 9 105934245 missense unknown
R5160:Col6a5 UTSW 9 105931009 missense unknown
R5182:Col6a5 UTSW 9 105857332 nonsense probably null
R5234:Col6a5 UTSW 9 105864205 missense probably damaging 1.00
R5252:Col6a5 UTSW 9 105940290 missense unknown
R5290:Col6a5 UTSW 9 105946083 missense unknown
R5313:Col6a5 UTSW 9 105945544 missense unknown
R5321:Col6a5 UTSW 9 105928465 missense unknown
R5466:Col6a5 UTSW 9 105931083 missense unknown
R5540:Col6a5 UTSW 9 105862776 missense probably benign 0.44
R5669:Col6a5 UTSW 9 105925998 missense unknown
R5789:Col6a5 UTSW 9 105864608 missense possibly damaging 0.91
R5801:Col6a5 UTSW 9 105948367 missense unknown
R5827:Col6a5 UTSW 9 105928120 nonsense probably null
R5839:Col6a5 UTSW 9 105945393 critical splice donor site probably null
R5908:Col6a5 UTSW 9 105862801 missense possibly damaging 0.88
R5970:Col6a5 UTSW 9 105945847 missense unknown
R6045:Col6a5 UTSW 9 105925918 missense unknown
R6107:Col6a5 UTSW 9 105892272 nonsense probably null
R6168:Col6a5 UTSW 9 105875787 critical splice donor site probably null
R6315:Col6a5 UTSW 9 105881970 missense probably damaging 1.00
R6317:Col6a5 UTSW 9 105889067 missense probably damaging 1.00
R6414:Col6a5 UTSW 9 105892266 splice site probably null
R6434:Col6a5 UTSW 9 105937345 missense unknown
R6456:Col6a5 UTSW 9 105945477 missense unknown
R6698:Col6a5 UTSW 9 105934175 missense unknown
R6876:Col6a5 UTSW 9 105937307 missense unknown
R6928:Col6a5 UTSW 9 105939919 missense unknown
X0054:Col6a5 UTSW 9 105915158 missense unknown
X0058:Col6a5 UTSW 9 105881778 nonsense probably null
Z1088:Col6a5 UTSW 9 105926067 missense unknown
Predicted Primers PCR Primer
(F):5'- AACATTAGATGCCCCAGTCTG -3'
(R):5'- GGAAGCAATTCAGACTGGGTC -3'

Sequencing Primer
(F):5'- CATTAGATGCCCCAGTCTGGAGAG -3'
(R):5'- AGACTGGGTCTGTGGTAACCC -3'
Posted On2018-10-18