Incidental Mutation 'R6885:Aox4'
ID536761
Institutional Source Beutler Lab
Gene Symbol Aox4
Ensembl Gene ENSMUSG00000038242
Gene Namealdehyde oxidase 4
Synonyms2310003G12Rik, AOH2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6885 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location58210397-58268597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58264378 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 1192 (S1192C)
Ref Sequence ENSEMBL: ENSMUSP00000048929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040442]
Predicted Effect probably damaging
Transcript: ENSMUST00000040442
AA Change: S1192C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048929
Gene: ENSMUSG00000038242
AA Change: S1192C

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.6e-10 PFAM
Pfam:Fer2_2 91 165 4.6e-30 PFAM
Pfam:FAD_binding_5 240 421 2.7e-47 PFAM
CO_deh_flav_C 428 532 1.19e-26 SMART
Ald_Xan_dh_C 596 699 8.22e-39 SMART
Pfam:Ald_Xan_dh_C2 709 1243 1.1e-178 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (58/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit a slight decrease in prenatal survival and epidermal thickening that is exacerbated by UV treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,520,109 I1025M probably benign Het
Adamtsl5 T A 10: 80,343,631 T164S probably benign Het
Ankar C T 1: 72,643,036 A1239T unknown Het
Atl2 T C 17: 79,852,553 D68G probably damaging Het
Btnl4 T C 17: 34,472,945 I228V probably benign Het
Catsper4 T C 4: 134,215,149 T231A probably benign Het
Ccl12 A T 11: 82,102,697 T54S probably damaging Het
Cntn1 T C 15: 92,243,099 probably null Het
Cog5 T A 12: 31,894,199 D694E probably damaging Het
Crat T A 2: 30,415,196 probably benign Het
Crot T C 5: 8,973,635 T418A probably benign Het
Cubn G A 2: 13,318,278 P2826L probably damaging Het
Dnah17 A G 11: 118,090,772 F1698L possibly damaging Het
Dock8 T A 19: 25,147,378 D1019E possibly damaging Het
Eps15 A G 4: 109,309,164 N85D probably damaging Het
Exoc1 T C 5: 76,559,042 S457P probably damaging Het
Ext1 G A 15: 53,101,692 T426I probably damaging Het
Fat1 T C 8: 44,952,452 S747P possibly damaging Het
Gas7 A G 11: 67,683,387 D396G probably damaging Het
Gm13023 T C 4: 143,793,533 C116R probably damaging Het
Gm5114 G T 7: 39,408,156 R680S probably benign Het
Gpcpd1 A T 2: 132,554,074 L94M possibly damaging Het
Gse1 C A 8: 120,229,482 probably benign Het
Hmgb1 T C 5: 149,050,661 E26G probably benign Het
Incenp C T 19: 9,875,132 R714Q unknown Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Ksr1 A G 11: 79,047,295 probably null Het
Lpin2 T G 17: 71,215,150 S60A probably damaging Het
Lrrc71 T C 3: 87,742,620 probably null Het
Mafb A G 2: 160,366,019 S220P possibly damaging Het
Maml3 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC 3: 51,697,579 Het
Mcmbp T C 7: 128,725,109 probably null Het
Olfr1191-ps1 A G 2: 88,643,597 T277A probably damaging Het
Olfr390 A T 11: 73,787,100 H54L possibly damaging Het
Paqr9 T C 9: 95,560,043 S29P probably benign Het
Parm1 A G 5: 91,594,210 T146A possibly damaging Het
Pgm1 T A 5: 64,103,878 F238L probably benign Het
Pigv A T 4: 133,665,481 F126Y probably damaging Het
Pitx2 T C 3: 129,218,608 M222T probably damaging Het
Plekhg6 T C 6: 125,378,730 N37S probably benign Het
Psme4 A T 11: 30,834,307 K961* probably null Het
Rbpj T C 5: 53,653,151 W392R probably damaging Het
Reg3a T A 6: 78,381,055 probably null Het
Rfc3 C T 5: 151,648,284 S85N probably benign Het
Rtn3 T C 19: 7,458,331 T80A probably benign Het
Sash1 T C 10: 8,784,221 T195A probably damaging Het
Ska1 A G 18: 74,206,839 V12A probably benign Het
Slc25a1 A G 16: 17,927,430 V80A probably benign Het
Slc26a5 A T 5: 21,834,344 V217D probably damaging Het
Slc46a1 A G 11: 78,466,979 D286G probably benign Het
Spata2l A T 8: 123,235,558 L88Q probably damaging Het
Sptbn1 T G 11: 30,138,634 Q876P probably benign Het
Tenm2 T A 11: 36,023,580 I2377F possibly damaging Het
Thbs4 A T 13: 92,762,869 D539E probably damaging Het
Tmem154 T A 3: 84,692,506 C162S possibly damaging Het
Tpcn1 T C 5: 120,544,437 E502G probably benign Het
Traf7 G A 17: 24,512,292 R257C probably benign Het
Tsc22d2 T C 3: 58,416,208 Y174H probably damaging Het
Usp8 A G 2: 126,752,310 E802G probably damaging Het
Vmn1r5 T C 6: 56,986,057 V239A possibly damaging Het
Vmn2r99 T A 17: 19,380,195 S494T possibly damaging Het
Zbtb38 A G 9: 96,686,464 F856L probably damaging Het
Other mutations in Aox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Aox4 APN 1 58239174 missense probably damaging 1.00
IGL01011:Aox4 APN 1 58240775 nonsense probably null
IGL01634:Aox4 APN 1 58221930 missense possibly damaging 0.81
IGL01689:Aox4 APN 1 58245161 splice site probably benign
IGL01874:Aox4 APN 1 58252084 missense probably damaging 1.00
IGL02104:Aox4 APN 1 58236657 splice site probably benign
IGL02744:Aox4 APN 1 58255552 missense possibly damaging 0.90
IGL02751:Aox4 APN 1 58259052 missense probably damaging 1.00
IGL03225:Aox4 APN 1 58247227 missense possibly damaging 0.94
IGL03247:Aox4 APN 1 58264367 missense probably damaging 1.00
IGL03369:Aox4 APN 1 58262587 missense probably benign 0.01
R0138:Aox4 UTSW 1 58228866 missense probably damaging 1.00
R0243:Aox4 UTSW 1 58213076 missense probably benign
R0368:Aox4 UTSW 1 58213079 missense probably benign 0.07
R0499:Aox4 UTSW 1 58263397 critical splice donor site probably null
R0513:Aox4 UTSW 1 58217519 missense probably benign
R0513:Aox4 UTSW 1 58247300 missense probably damaging 1.00
R0546:Aox4 UTSW 1 58250174 missense probably damaging 1.00
R0591:Aox4 UTSW 1 58239102 splice site probably benign
R0825:Aox4 UTSW 1 58248909 missense possibly damaging 0.55
R1912:Aox4 UTSW 1 58264402 missense probably damaging 1.00
R1934:Aox4 UTSW 1 58245936 missense probably benign 0.01
R2180:Aox4 UTSW 1 58213067 missense probably benign 0.00
R2293:Aox4 UTSW 1 58221937 missense probably damaging 0.99
R3017:Aox4 UTSW 1 58235204 missense probably benign
R3744:Aox4 UTSW 1 58245870 missense probably damaging 1.00
R3745:Aox4 UTSW 1 58245870 missense probably damaging 1.00
R3830:Aox4 UTSW 1 58255511 missense probably damaging 0.99
R3856:Aox4 UTSW 1 58253934 missense probably damaging 1.00
R4214:Aox4 UTSW 1 58221892 missense probably damaging 0.99
R4484:Aox4 UTSW 1 58262571 missense probably damaging 1.00
R4706:Aox4 UTSW 1 58266787 missense probably damaging 1.00
R4710:Aox4 UTSW 1 58255638 missense probably damaging 1.00
R4729:Aox4 UTSW 1 58259077 nonsense probably null
R4769:Aox4 UTSW 1 58259148 missense probably null 1.00
R4809:Aox4 UTSW 1 58266649 missense probably damaging 1.00
R4989:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5082:Aox4 UTSW 1 58231483 missense possibly damaging 0.63
R5102:Aox4 UTSW 1 58240778 missense probably damaging 1.00
R5114:Aox4 UTSW 1 58246286 missense possibly damaging 0.89
R5133:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5134:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5185:Aox4 UTSW 1 58254318 missense probably damaging 1.00
R5217:Aox4 UTSW 1 58246241 nonsense probably null
R5426:Aox4 UTSW 1 58220094 missense probably damaging 1.00
R5443:Aox4 UTSW 1 58233992 splice site probably null
R5708:Aox4 UTSW 1 58245873 missense possibly damaging 0.69
R6052:Aox4 UTSW 1 58254318 nonsense probably null
R6167:Aox4 UTSW 1 58263935 missense probably damaging 1.00
R6179:Aox4 UTSW 1 58231503 missense probably benign
R6196:Aox4 UTSW 1 58217526 missense probably damaging 1.00
R6513:Aox4 UTSW 1 58213053 missense probably benign 0.01
R6781:Aox4 UTSW 1 58245109 missense probably benign 0.03
R7082:Aox4 UTSW 1 58224193 missense possibly damaging 0.82
R7127:Aox4 UTSW 1 58228874 missense probably benign 0.00
R7153:Aox4 UTSW 1 58250219 missense probably damaging 0.99
R7371:Aox4 UTSW 1 58263854 missense probably damaging 1.00
X0021:Aox4 UTSW 1 58247295 nonsense probably null
X0028:Aox4 UTSW 1 58254183 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGGGACAGACACATAATCTTTG -3'
(R):5'- AATGGCCACCTTTCTGAAGC -3'

Sequencing Primer
(F):5'- GTAAGTACACTGTAGCCGTCTTCAG -3'
(R):5'- GAAGCCTCTTCTCTCATTCCATCAC -3'
Posted On2018-10-18