Incidental Mutation 'R6885:Tmem154'
ID536770
Institutional Source Beutler Lab
Gene Symbol Tmem154
Ensembl Gene ENSMUSG00000056498
Gene Nametransmembrane protein 154
Synonyms9930117H01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6885 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location84666192-84704575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84692506 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 162 (C162S)
Ref Sequence ENSEMBL: ENSMUSP00000103310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107682] [ENSMUST00000154148]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107682
AA Change: C162S

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103310
Gene: ENSMUSG00000056498
AA Change: C162S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM154 24 163 6.2e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,520,109 I1025M probably benign Het
Adamtsl5 T A 10: 80,343,631 T164S probably benign Het
Ankar C T 1: 72,643,036 A1239T unknown Het
Aox4 A T 1: 58,264,378 S1192C probably damaging Het
Atl2 T C 17: 79,852,553 D68G probably damaging Het
Btnl4 T C 17: 34,472,945 I228V probably benign Het
Catsper4 T C 4: 134,215,149 T231A probably benign Het
Ccl12 A T 11: 82,102,697 T54S probably damaging Het
Cntn1 T C 15: 92,243,099 probably null Het
Cog5 T A 12: 31,894,199 D694E probably damaging Het
Crat T A 2: 30,415,196 probably benign Het
Crot T C 5: 8,973,635 T418A probably benign Het
Cubn G A 2: 13,318,278 P2826L probably damaging Het
Dnah17 A G 11: 118,090,772 F1698L possibly damaging Het
Dock8 T A 19: 25,147,378 D1019E possibly damaging Het
Eps15 A G 4: 109,309,164 N85D probably damaging Het
Exoc1 T C 5: 76,559,042 S457P probably damaging Het
Ext1 G A 15: 53,101,692 T426I probably damaging Het
Fat1 T C 8: 44,952,452 S747P possibly damaging Het
Gas7 A G 11: 67,683,387 D396G probably damaging Het
Gm13023 T C 4: 143,793,533 C116R probably damaging Het
Gm5114 G T 7: 39,408,156 R680S probably benign Het
Gpcpd1 A T 2: 132,554,074 L94M possibly damaging Het
Gse1 C A 8: 120,229,482 probably benign Het
Hmgb1 T C 5: 149,050,661 E26G probably benign Het
Incenp C T 19: 9,875,132 R714Q unknown Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Ksr1 A G 11: 79,047,295 probably null Het
Lpin2 T G 17: 71,215,150 S60A probably damaging Het
Lrrc71 T C 3: 87,742,620 probably null Het
Mafb A G 2: 160,366,019 S220P possibly damaging Het
Maml3 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC 3: 51,697,579 Het
Mcmbp T C 7: 128,725,109 probably null Het
Olfr1191-ps1 A G 2: 88,643,597 T277A probably damaging Het
Olfr390 A T 11: 73,787,100 H54L possibly damaging Het
Paqr9 T C 9: 95,560,043 S29P probably benign Het
Parm1 A G 5: 91,594,210 T146A possibly damaging Het
Pgm1 T A 5: 64,103,878 F238L probably benign Het
Pigv A T 4: 133,665,481 F126Y probably damaging Het
Pitx2 T C 3: 129,218,608 M222T probably damaging Het
Plekhg6 T C 6: 125,378,730 N37S probably benign Het
Psme4 A T 11: 30,834,307 K961* probably null Het
Rbpj T C 5: 53,653,151 W392R probably damaging Het
Reg3a T A 6: 78,381,055 probably null Het
Rfc3 C T 5: 151,648,284 S85N probably benign Het
Rtn3 T C 19: 7,458,331 T80A probably benign Het
Sash1 T C 10: 8,784,221 T195A probably damaging Het
Ska1 A G 18: 74,206,839 V12A probably benign Het
Slc25a1 A G 16: 17,927,430 V80A probably benign Het
Slc26a5 A T 5: 21,834,344 V217D probably damaging Het
Slc46a1 A G 11: 78,466,979 D286G probably benign Het
Spata2l A T 8: 123,235,558 L88Q probably damaging Het
Sptbn1 T G 11: 30,138,634 Q876P probably benign Het
Tenm2 T A 11: 36,023,580 I2377F possibly damaging Het
Thbs4 A T 13: 92,762,869 D539E probably damaging Het
Tpcn1 T C 5: 120,544,437 E502G probably benign Het
Traf7 G A 17: 24,512,292 R257C probably benign Het
Tsc22d2 T C 3: 58,416,208 Y174H probably damaging Het
Usp8 A G 2: 126,752,310 E802G probably damaging Het
Vmn1r5 T C 6: 56,986,057 V239A possibly damaging Het
Vmn2r99 T A 17: 19,380,195 S494T possibly damaging Het
Zbtb38 A G 9: 96,686,464 F856L probably damaging Het
Other mutations in Tmem154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Tmem154 APN 3 84684415 missense probably benign 0.05
IGL01516:Tmem154 APN 3 84684590 missense probably benign
IGL01670:Tmem154 APN 3 84684230 missense probably damaging 0.98
IGL02955:Tmem154 APN 3 84684201 intron probably benign
IGL03406:Tmem154 APN 3 84684260 missense probably benign 0.00
R6245:Tmem154 UTSW 3 84684296 missense possibly damaging 0.83
R7287:Tmem154 UTSW 3 84690563 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCCCTGTATCTGCGTGATC -3'
(R):5'- ACGATTCCTGACTGCACATTCC -3'

Sequencing Primer
(F):5'- TTACCGTTTCAGGAGCCTCGG -3'
(R):5'- GACTGCACATTCCTCCCTGTAAAC -3'
Posted On2018-10-18