Incidental Mutation 'R6885:Rbpj'
ID536779
Institutional Source Beutler Lab
Gene Symbol Rbpj
Ensembl Gene ENSMUSG00000039191
Gene Namerecombination signal binding protein for immunoglobulin kappa J region
SynonymsRBP-J kappa, CBF1, Igkjrb, RBPjk, Igkrsbp, Rbpsuh
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6885 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location53466152-53657362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53653151 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 392 (W392R)
Ref Sequence ENSEMBL: ENSMUSP00000143866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037618] [ENSMUST00000087360] [ENSMUST00000113865] [ENSMUST00000201883] [ENSMUST00000201912] [ENSMUST00000201991]
Predicted Effect probably damaging
Transcript: ENSMUST00000037618
AA Change: W411R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040694
Gene: ENSMUSG00000039191
AA Change: W411R

DomainStartEndE-ValueType
LAG1_DNAbind 73 204 2.97e-86 SMART
BTD 205 354 8.01e-92 SMART
SCOP:d1a02n1 380 472 8e-29 SMART
low complexity region 508 526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087360
AA Change: W370R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084618
Gene: ENSMUSG00000039191
AA Change: W370R

DomainStartEndE-ValueType
LAG1_DNAbind 32 163 2.97e-86 SMART
BTD 164 313 8.01e-92 SMART
Pfam:TIG 340 429 3.6e-9 PFAM
low complexity region 467 485 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113865
AA Change: W372R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109496
Gene: ENSMUSG00000039191
AA Change: W372R

DomainStartEndE-ValueType
LAG1_DNAbind 34 165 2.97e-86 SMART
BTD 166 315 8.01e-92 SMART
Pfam:TIG 342 431 6.1e-9 PFAM
low complexity region 469 487 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201883
AA Change: W350R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143846
Gene: ENSMUSG00000039191
AA Change: W350R

DomainStartEndE-ValueType
LAG1_DNAbind 12 143 2.3e-90 SMART
BTD 144 293 6e-96 SMART
SCOP:d1a02n1 319 411 4e-29 SMART
low complexity region 447 465 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201912
AA Change: W392R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143866
Gene: ENSMUSG00000039191
AA Change: W392R

DomainStartEndE-ValueType
LAG1_DNAbind 54 185 2.97e-86 SMART
BTD 186 335 8.01e-92 SMART
SCOP:d1a02n1 361 453 6e-29 SMART
low complexity region 489 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201991
SMART Domains Protein: ENSMUSP00000144617
Gene: ENSMUSG00000039191

DomainStartEndE-ValueType
LAG1_DNAbind 42 173 2.3e-90 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulator important in the Notch signaling pathway. The encoded protein acts as a repressor when not bound to Notch proteins and an activator when bound to Notch proteins. It is thought to function by recruiting chromatin remodeling complexes containing histone deacetylase or histone acetylase proteins to Notch signaling pathway genes. Several transcript variants encoding different isoforms have been found for this gene, and several pseudogenes of this gene exist on chromosome 9. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,520,109 I1025M probably benign Het
Adamtsl5 T A 10: 80,343,631 T164S probably benign Het
Ankar C T 1: 72,643,036 A1239T unknown Het
Aox4 A T 1: 58,264,378 S1192C probably damaging Het
Atl2 T C 17: 79,852,553 D68G probably damaging Het
Btnl4 T C 17: 34,472,945 I228V probably benign Het
Catsper4 T C 4: 134,215,149 T231A probably benign Het
Ccl12 A T 11: 82,102,697 T54S probably damaging Het
Cntn1 T C 15: 92,243,099 probably null Het
Cog5 T A 12: 31,894,199 D694E probably damaging Het
Crat T A 2: 30,415,196 probably benign Het
Crot T C 5: 8,973,635 T418A probably benign Het
Cubn G A 2: 13,318,278 P2826L probably damaging Het
Dnah17 A G 11: 118,090,772 F1698L possibly damaging Het
Dock8 T A 19: 25,147,378 D1019E possibly damaging Het
Eps15 A G 4: 109,309,164 N85D probably damaging Het
Exoc1 T C 5: 76,559,042 S457P probably damaging Het
Ext1 G A 15: 53,101,692 T426I probably damaging Het
Fat1 T C 8: 44,952,452 S747P possibly damaging Het
Gas7 A G 11: 67,683,387 D396G probably damaging Het
Gm13023 T C 4: 143,793,533 C116R probably damaging Het
Gm5114 G T 7: 39,408,156 R680S probably benign Het
Gpcpd1 A T 2: 132,554,074 L94M possibly damaging Het
Gse1 C A 8: 120,229,482 probably benign Het
Hmgb1 T C 5: 149,050,661 E26G probably benign Het
Incenp C T 19: 9,875,132 R714Q unknown Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Ksr1 A G 11: 79,047,295 probably null Het
Lpin2 T G 17: 71,215,150 S60A probably damaging Het
Lrrc71 T C 3: 87,742,620 probably null Het
Mafb A G 2: 160,366,019 S220P possibly damaging Het
Maml3 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC 3: 51,697,579 Het
Mcmbp T C 7: 128,725,109 probably null Het
Olfr1191-ps1 A G 2: 88,643,597 T277A probably damaging Het
Olfr390 A T 11: 73,787,100 H54L possibly damaging Het
Paqr9 T C 9: 95,560,043 S29P probably benign Het
Parm1 A G 5: 91,594,210 T146A possibly damaging Het
Pgm1 T A 5: 64,103,878 F238L probably benign Het
Pigv A T 4: 133,665,481 F126Y probably damaging Het
Pitx2 T C 3: 129,218,608 M222T probably damaging Het
Plekhg6 T C 6: 125,378,730 N37S probably benign Het
Psme4 A T 11: 30,834,307 K961* probably null Het
Reg3a T A 6: 78,381,055 probably null Het
Rfc3 C T 5: 151,648,284 S85N probably benign Het
Rtn3 T C 19: 7,458,331 T80A probably benign Het
Sash1 T C 10: 8,784,221 T195A probably damaging Het
Ska1 A G 18: 74,206,839 V12A probably benign Het
Slc25a1 A G 16: 17,927,430 V80A probably benign Het
Slc26a5 A T 5: 21,834,344 V217D probably damaging Het
Slc46a1 A G 11: 78,466,979 D286G probably benign Het
Spata2l A T 8: 123,235,558 L88Q probably damaging Het
Sptbn1 T G 11: 30,138,634 Q876P probably benign Het
Tenm2 T A 11: 36,023,580 I2377F possibly damaging Het
Thbs4 A T 13: 92,762,869 D539E probably damaging Het
Tmem154 T A 3: 84,692,506 C162S possibly damaging Het
Tpcn1 T C 5: 120,544,437 E502G probably benign Het
Traf7 G A 17: 24,512,292 R257C probably benign Het
Tsc22d2 T C 3: 58,416,208 Y174H probably damaging Het
Usp8 A G 2: 126,752,310 E802G probably damaging Het
Vmn1r5 T C 6: 56,986,057 V239A possibly damaging Het
Vmn2r99 T A 17: 19,380,195 S494T possibly damaging Het
Zbtb38 A G 9: 96,686,464 F856L probably damaging Het
Other mutations in Rbpj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Rbpj APN 5 53651386 missense probably damaging 1.00
IGL02537:Rbpj APN 5 53642143 missense probably damaging 1.00
R0676:Rbpj UTSW 5 53646048 splice site probably benign
R2372:Rbpj UTSW 5 53642195 splice site probably benign
R3814:Rbpj UTSW 5 53653172 nonsense probably null
R4153:Rbpj UTSW 5 53649447 missense probably damaging 1.00
R5023:Rbpj UTSW 5 53649415 missense probably damaging 1.00
R5240:Rbpj UTSW 5 53649440 missense probably damaging 1.00
R5341:Rbpj UTSW 5 53642083 missense possibly damaging 0.71
R6088:Rbpj UTSW 5 53651368 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TGCTGTTCTGAGCTATAACTTGCC -3'
(R):5'- CATGCTCTCTCCACATCTAAGG -3'

Sequencing Primer
(F):5'- GTTCTGAGCTATAACTTGCCATAATC -3'
(R):5'- GGAGGAAACACACACCATTTAG -3'
Posted On2018-10-18