Incidental Mutation 'R6883:Rfc3'
ID536785
Institutional Source Beutler Lab
Gene Symbol Rfc3
Ensembl Gene ENSMUSG00000033970
Gene Namereplication factor C (activator 1) 3
Synonyms2810416I22Rik, Recc3, 38kDa, 38kDa
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R6883 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location151642756-151651242 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 151648284 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 85 (S85N)
Ref Sequence ENSEMBL: ENSMUSP00000039621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038131]
Predicted Effect probably benign
Transcript: ENSMUST00000038131
AA Change: S85N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000039621
Gene: ENSMUSG00000033970
AA Change: S85N

DomainStartEndE-ValueType
AAA 34 190 1.5e-6 SMART
Pfam:Rep_fac_C 216 338 7.8e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kDa. This gene encodes the 38 kDa subunit. This subunit is essential for the interaction between the 140 kDa subunit and the core complex that consists of the 36, 37, and 40 kDa subunits. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,520,109 I1025M probably benign Het
Adamtsl5 T A 10: 80,343,631 T164S probably benign Het
Ankar C T 1: 72,643,036 A1239T unknown Het
Aox4 A T 1: 58,264,378 S1192C probably damaging Het
Atl2 T C 17: 79,852,553 D68G probably damaging Het
Btnl4 T C 17: 34,472,945 I228V probably benign Het
Catsper4 T C 4: 134,215,149 T231A probably benign Het
Ccl12 A T 11: 82,102,697 T54S probably damaging Het
Cntn1 T C 15: 92,243,099 probably null Het
Cog5 T A 12: 31,894,199 D694E probably damaging Het
Crat T A 2: 30,415,196 probably benign Het
Crot T C 5: 8,973,635 T418A probably benign Het
Cubn G A 2: 13,318,278 P2826L probably damaging Het
Dnah17 A G 11: 118,090,772 F1698L possibly damaging Het
Dock8 T A 19: 25,147,378 D1019E possibly damaging Het
Eps15 A G 4: 109,309,164 N85D probably damaging Het
Exoc1 T C 5: 76,559,042 S457P probably damaging Het
Ext1 G A 15: 53,101,692 T426I probably damaging Het
Fat1 T C 8: 44,952,452 S747P possibly damaging Het
Gas7 A G 11: 67,683,387 D396G probably damaging Het
Gm13023 T C 4: 143,793,533 C116R probably damaging Het
Gm5114 G T 7: 39,408,156 R680S probably benign Het
Gpcpd1 A T 2: 132,554,074 L94M possibly damaging Het
Gse1 C A 8: 120,229,482 probably benign Het
Hmgb1 T C 5: 149,050,661 E26G probably benign Het
Incenp C T 19: 9,875,132 R714Q unknown Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Ksr1 A G 11: 79,047,295 probably null Het
Lpin2 T G 17: 71,215,150 S60A probably damaging Het
Lrrc71 T C 3: 87,742,620 probably null Het
Mafb A G 2: 160,366,019 S220P possibly damaging Het
Maml3 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC 3: 51,697,579 Het
Mcmbp T C 7: 128,725,109 probably null Het
Olfr1191-ps1 A G 2: 88,643,597 T277A probably damaging Het
Olfr390 A T 11: 73,787,100 H54L possibly damaging Het
Paqr9 T C 9: 95,560,043 S29P probably benign Het
Parm1 A G 5: 91,594,210 T146A possibly damaging Het
Pgm1 T A 5: 64,103,878 F238L probably benign Het
Pigv A T 4: 133,665,481 F126Y probably damaging Het
Pitx2 T C 3: 129,218,608 M222T probably damaging Het
Plekhg6 T C 6: 125,378,730 N37S probably benign Het
Psme4 A T 11: 30,834,307 K961* probably null Het
Rbpj T C 5: 53,653,151 W392R probably damaging Het
Reg3a T A 6: 78,381,055 probably null Het
Rtn3 T C 19: 7,458,331 T80A probably benign Het
Sash1 T C 10: 8,784,221 T195A probably damaging Het
Ska1 A G 18: 74,206,839 V12A probably benign Het
Slc25a1 A G 16: 17,927,430 V80A probably benign Het
Slc26a5 A T 5: 21,834,344 V217D probably damaging Het
Slc46a1 A G 11: 78,466,979 D286G probably benign Het
Spata2l A T 8: 123,235,558 L88Q probably damaging Het
Sptbn1 T G 11: 30,138,634 Q876P probably benign Het
Tenm2 T A 11: 36,023,580 I2377F possibly damaging Het
Thbs4 A T 13: 92,762,869 D539E probably damaging Het
Tmem154 T A 3: 84,692,506 C162S possibly damaging Het
Tpcn1 T C 5: 120,544,437 E502G probably benign Het
Traf7 G A 17: 24,512,292 R257C probably benign Het
Tsc22d2 T C 3: 58,416,208 Y174H probably damaging Het
Usp8 A G 2: 126,752,310 E802G probably damaging Het
Vmn1r5 T C 6: 56,986,057 V239A possibly damaging Het
Vmn2r99 T A 17: 19,380,195 S494T possibly damaging Het
Zbtb38 A G 9: 96,686,464 F856L probably damaging Het
Other mutations in Rfc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Rfc3 APN 5 151642936 missense probably benign 0.00
IGL02429:Rfc3 APN 5 151651131 missense probably benign 0.01
IGL02588:Rfc3 APN 5 151642916 missense possibly damaging 0.69
IGL02878:Rfc3 APN 5 151642914 makesense probably null
IGL03109:Rfc3 APN 5 151643094 missense probably benign 0.10
R0129:Rfc3 UTSW 5 151651151 start codon destroyed probably null 1.00
R0456:Rfc3 UTSW 5 151647523 missense possibly damaging 0.61
R2015:Rfc3 UTSW 5 151647538 critical splice acceptor site probably null
R2096:Rfc3 UTSW 5 151644918 missense probably benign 0.03
R2306:Rfc3 UTSW 5 151643778 missense probably damaging 1.00
R4223:Rfc3 UTSW 5 151651172 start gained probably benign
R4739:Rfc3 UTSW 5 151644776 splice site probably benign
R4906:Rfc3 UTSW 5 151647495 missense probably damaging 0.98
R4945:Rfc3 UTSW 5 151642985 missense probably damaging 1.00
R5643:Rfc3 UTSW 5 151649979 missense probably benign 0.05
R5644:Rfc3 UTSW 5 151649979 missense probably benign 0.05
R6011:Rfc3 UTSW 5 151643719 missense probably damaging 1.00
R6181:Rfc3 UTSW 5 151647520 missense probably damaging 1.00
Z1088:Rfc3 UTSW 5 151644862 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGACCTAAGGGACCTCTG -3'
(R):5'- GATCGCAAAGACACATTATTCAGTG -3'

Sequencing Primer
(F):5'- GGGACCTCTGACAACAGTATTTTAG -3'
(R):5'- GACTGTAGATAGTTGGCAG -3'
Posted On2018-10-18