Incidental Mutation 'R6885:Olfr390'
ID536803
Institutional Source Beutler Lab
Gene Symbol Olfr390
Ensembl Gene ENSMUSG00000069818
Gene Nameolfactory receptor 390
SynonymsMOR135-26, GA_x6K02T2P1NL-3938806-3939741
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6885 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73782964-73790446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73787100 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 54 (H54L)
Ref Sequence ENSEMBL: ENSMUSP00000148992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092919] [ENSMUST00000120081] [ENSMUST00000206815] [ENSMUST00000215161]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092919
AA Change: H54L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090598
Gene: ENSMUSG00000069818
AA Change: H54L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.1e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.2e-9 PFAM
Pfam:7tm_1 41 290 6.8e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120081
AA Change: H54L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113472
Gene: ENSMUSG00000069818
AA Change: H54L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 7.2e-9 PFAM
Pfam:7tm_1 41 290 1.4e-36 PFAM
Pfam:7tm_4 139 283 5.6e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000206815
AA Change: H54L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215161
AA Change: H54L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,520,109 I1025M probably benign Het
Adamtsl5 T A 10: 80,343,631 T164S probably benign Het
Ankar C T 1: 72,643,036 A1239T unknown Het
Aox4 A T 1: 58,264,378 S1192C probably damaging Het
Atl2 T C 17: 79,852,553 D68G probably damaging Het
Btnl4 T C 17: 34,472,945 I228V probably benign Het
Catsper4 T C 4: 134,215,149 T231A probably benign Het
Ccl12 A T 11: 82,102,697 T54S probably damaging Het
Cntn1 T C 15: 92,243,099 probably null Het
Cog5 T A 12: 31,894,199 D694E probably damaging Het
Crat T A 2: 30,415,196 probably benign Het
Crot T C 5: 8,973,635 T418A probably benign Het
Cubn G A 2: 13,318,278 P2826L probably damaging Het
Dnah17 A G 11: 118,090,772 F1698L possibly damaging Het
Dock8 T A 19: 25,147,378 D1019E possibly damaging Het
Eps15 A G 4: 109,309,164 N85D probably damaging Het
Exoc1 T C 5: 76,559,042 S457P probably damaging Het
Ext1 G A 15: 53,101,692 T426I probably damaging Het
Fat1 T C 8: 44,952,452 S747P possibly damaging Het
Gas7 A G 11: 67,683,387 D396G probably damaging Het
Gm13023 T C 4: 143,793,533 C116R probably damaging Het
Gm5114 G T 7: 39,408,156 R680S probably benign Het
Gpcpd1 A T 2: 132,554,074 L94M possibly damaging Het
Gse1 C A 8: 120,229,482 probably benign Het
Hmgb1 T C 5: 149,050,661 E26G probably benign Het
Incenp C T 19: 9,875,132 R714Q unknown Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Ksr1 A G 11: 79,047,295 probably null Het
Lpin2 T G 17: 71,215,150 S60A probably damaging Het
Lrrc71 T C 3: 87,742,620 probably null Het
Mafb A G 2: 160,366,019 S220P possibly damaging Het
Maml3 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC 3: 51,697,579 Het
Mcmbp T C 7: 128,725,109 probably null Het
Olfr1191-ps1 A G 2: 88,643,597 T277A probably damaging Het
Paqr9 T C 9: 95,560,043 S29P probably benign Het
Parm1 A G 5: 91,594,210 T146A possibly damaging Het
Pgm1 T A 5: 64,103,878 F238L probably benign Het
Pigv A T 4: 133,665,481 F126Y probably damaging Het
Pitx2 T C 3: 129,218,608 M222T probably damaging Het
Plekhg6 T C 6: 125,378,730 N37S probably benign Het
Psme4 A T 11: 30,834,307 K961* probably null Het
Rbpj T C 5: 53,653,151 W392R probably damaging Het
Reg3a T A 6: 78,381,055 probably null Het
Rfc3 C T 5: 151,648,284 S85N probably benign Het
Rtn3 T C 19: 7,458,331 T80A probably benign Het
Sash1 T C 10: 8,784,221 T195A probably damaging Het
Ska1 A G 18: 74,206,839 V12A probably benign Het
Slc25a1 A G 16: 17,927,430 V80A probably benign Het
Slc26a5 A T 5: 21,834,344 V217D probably damaging Het
Slc46a1 A G 11: 78,466,979 D286G probably benign Het
Spata2l A T 8: 123,235,558 L88Q probably damaging Het
Sptbn1 T G 11: 30,138,634 Q876P probably benign Het
Tenm2 T A 11: 36,023,580 I2377F possibly damaging Het
Thbs4 A T 13: 92,762,869 D539E probably damaging Het
Tmem154 T A 3: 84,692,506 C162S possibly damaging Het
Tpcn1 T C 5: 120,544,437 E502G probably benign Het
Traf7 G A 17: 24,512,292 R257C probably benign Het
Tsc22d2 T C 3: 58,416,208 Y174H probably damaging Het
Usp8 A G 2: 126,752,310 E802G probably damaging Het
Vmn1r5 T C 6: 56,986,057 V239A possibly damaging Het
Vmn2r99 T A 17: 19,380,195 S494T possibly damaging Het
Zbtb38 A G 9: 96,686,464 F856L probably damaging Het
Other mutations in Olfr390
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Olfr390 APN 11 73787580 missense probably damaging 1.00
IGL01621:Olfr390 APN 11 73787277 missense probably damaging 0.99
IGL01630:Olfr390 APN 11 73787861 missense probably benign 0.14
IGL01866:Olfr390 APN 11 73787828 missense probably benign 0.28
IGL02577:Olfr390 APN 11 73787046 missense probably damaging 1.00
IGL02617:Olfr390 APN 11 73787734 missense probably benign 0.01
IGL03017:Olfr390 APN 11 73787518 missense probably benign 0.01
IGL03215:Olfr390 APN 11 73787385 missense probably damaging 1.00
IGL03342:Olfr390 APN 11 73787483 missense probably benign 0.03
IGL03098:Olfr390 UTSW 11 73787703 missense probably benign 0.29
R0115:Olfr390 UTSW 11 73787315 missense possibly damaging 0.45
R0217:Olfr390 UTSW 11 73787388 missense possibly damaging 0.90
R1971:Olfr390 UTSW 11 73787790 missense probably damaging 1.00
R2033:Olfr390 UTSW 11 73787438 missense probably benign 0.15
R2058:Olfr390 UTSW 11 73787274 missense probably benign 0.00
R3051:Olfr390 UTSW 11 73787234 missense probably benign 0.01
R3622:Olfr390 UTSW 11 73787741 missense probably benign 0.00
R3913:Olfr390 UTSW 11 73787696 missense probably damaging 1.00
R4545:Olfr390 UTSW 11 73787166 missense probably damaging 1.00
R4656:Olfr390 UTSW 11 73787511 missense probably damaging 1.00
R5120:Olfr390 UTSW 11 73786964 missense probably benign 0.01
R5635:Olfr390 UTSW 11 73787634 missense probably benign 0.26
R6020:Olfr390 UTSW 11 73787552 missense probably benign 0.03
R6151:Olfr390 UTSW 11 73787695 nonsense probably null
R6984:Olfr390 UTSW 11 73787777 missense possibly damaging 0.91
R7057:Olfr390 UTSW 11 73787148 missense possibly damaging 0.88
R7120:Olfr390 UTSW 11 73787114 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACATTACAGGAAGATCATGCCTG -3'
(R):5'- GAAGCAGATGGCCACATAGC -3'

Sequencing Primer
(F):5'- TTACAGGAAGATCATGCCTGGAAAC -3'
(R):5'- CATGGCCACAAGTAGGAAGTTCTC -3'
Posted On2018-10-18