Incidental Mutation 'R6885:Slc46a1'
ID536804
Institutional Source Beutler Lab
Gene Symbol Slc46a1
Ensembl Gene ENSMUSG00000020829
Gene Namesolute carrier family 46, member 1
Synonyms1110002C08Rik, D11Ertd18e, heme carrier protein 1, HCP1, PCFT
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6885 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location78465697-78472059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78466979 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 286 (D286G)
Ref Sequence ENSEMBL: ENSMUSP00000001126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001126] [ENSMUST00000146431]
Predicted Effect probably benign
Transcript: ENSMUST00000001126
AA Change: D286G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000001126
Gene: ENSMUSG00000020829
AA Change: D286G

DomainStartEndE-ValueType
Pfam:MFS_1 29 443 5.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146431
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane proton-coupled folate transporter protein that facilitates the movement of folate and antifolate substrates across cell membranes, optimally in acidic pH environments. This protein is also expressed in the brain and choroid plexus where it transports folates into the central nervous system. This protein further functions as a heme transporter in duodenal enterocytes, and potentially in other tissues like liver and kidney. Its localization to the apical membrane or cytoplasm of intestinal cells is modulated by dietary iron levels. Mutations in this gene are associated with autosomal recessive hereditary folate malabsorption disease. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating and liver levels of N-homocysteine and total homocysteine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,520,109 I1025M probably benign Het
Adamtsl5 T A 10: 80,343,631 T164S probably benign Het
Ankar C T 1: 72,643,036 A1239T unknown Het
Aox4 A T 1: 58,264,378 S1192C probably damaging Het
Atl2 T C 17: 79,852,553 D68G probably damaging Het
Btnl4 T C 17: 34,472,945 I228V probably benign Het
Catsper4 T C 4: 134,215,149 T231A probably benign Het
Ccl12 A T 11: 82,102,697 T54S probably damaging Het
Cntn1 T C 15: 92,243,099 probably null Het
Cog5 T A 12: 31,894,199 D694E probably damaging Het
Crat T A 2: 30,415,196 probably benign Het
Crot T C 5: 8,973,635 T418A probably benign Het
Cubn G A 2: 13,318,278 P2826L probably damaging Het
Dnah17 A G 11: 118,090,772 F1698L possibly damaging Het
Dock8 T A 19: 25,147,378 D1019E possibly damaging Het
Eps15 A G 4: 109,309,164 N85D probably damaging Het
Exoc1 T C 5: 76,559,042 S457P probably damaging Het
Ext1 G A 15: 53,101,692 T426I probably damaging Het
Fat1 T C 8: 44,952,452 S747P possibly damaging Het
Gas7 A G 11: 67,683,387 D396G probably damaging Het
Gm13023 T C 4: 143,793,533 C116R probably damaging Het
Gm5114 G T 7: 39,408,156 R680S probably benign Het
Gpcpd1 A T 2: 132,554,074 L94M possibly damaging Het
Gse1 C A 8: 120,229,482 probably benign Het
Hmgb1 T C 5: 149,050,661 E26G probably benign Het
Incenp C T 19: 9,875,132 R714Q unknown Het
Krt73 T C 15: 101,796,398 E351G probably damaging Het
Ksr1 A G 11: 79,047,295 probably null Het
Lpin2 T G 17: 71,215,150 S60A probably damaging Het
Lrrc71 T C 3: 87,742,620 probably null Het
Mafb A G 2: 160,366,019 S220P possibly damaging Het
Maml3 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC 3: 51,697,579 Het
Mcmbp T C 7: 128,725,109 probably null Het
Olfr1191-ps1 A G 2: 88,643,597 T277A probably damaging Het
Olfr390 A T 11: 73,787,100 H54L possibly damaging Het
Paqr9 T C 9: 95,560,043 S29P probably benign Het
Parm1 A G 5: 91,594,210 T146A possibly damaging Het
Pgm1 T A 5: 64,103,878 F238L probably benign Het
Pigv A T 4: 133,665,481 F126Y probably damaging Het
Pitx2 T C 3: 129,218,608 M222T probably damaging Het
Plekhg6 T C 6: 125,378,730 N37S probably benign Het
Psme4 A T 11: 30,834,307 K961* probably null Het
Rbpj T C 5: 53,653,151 W392R probably damaging Het
Reg3a T A 6: 78,381,055 probably null Het
Rfc3 C T 5: 151,648,284 S85N probably benign Het
Rtn3 T C 19: 7,458,331 T80A probably benign Het
Sash1 T C 10: 8,784,221 T195A probably damaging Het
Ska1 A G 18: 74,206,839 V12A probably benign Het
Slc25a1 A G 16: 17,927,430 V80A probably benign Het
Slc26a5 A T 5: 21,834,344 V217D probably damaging Het
Spata2l A T 8: 123,235,558 L88Q probably damaging Het
Sptbn1 T G 11: 30,138,634 Q876P probably benign Het
Tenm2 T A 11: 36,023,580 I2377F possibly damaging Het
Thbs4 A T 13: 92,762,869 D539E probably damaging Het
Tmem154 T A 3: 84,692,506 C162S possibly damaging Het
Tpcn1 T C 5: 120,544,437 E502G probably benign Het
Traf7 G A 17: 24,512,292 R257C probably benign Het
Tsc22d2 T C 3: 58,416,208 Y174H probably damaging Het
Usp8 A G 2: 126,752,310 E802G probably damaging Het
Vmn1r5 T C 6: 56,986,057 V239A possibly damaging Het
Vmn2r99 T A 17: 19,380,195 S494T possibly damaging Het
Zbtb38 A G 9: 96,686,464 F856L probably damaging Het
Other mutations in Slc46a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0242:Slc46a1 UTSW 11 78468667 missense possibly damaging 0.58
R0242:Slc46a1 UTSW 11 78468667 missense possibly damaging 0.58
R0255:Slc46a1 UTSW 11 78470799 missense probably damaging 1.00
R1356:Slc46a1 UTSW 11 78470724 missense probably benign 0.16
R2088:Slc46a1 UTSW 11 78468645 missense possibly damaging 0.81
R2273:Slc46a1 UTSW 11 78466423 missense probably benign 0.00
R2274:Slc46a1 UTSW 11 78466423 missense probably benign 0.00
R2275:Slc46a1 UTSW 11 78466423 missense probably benign 0.00
R4627:Slc46a1 UTSW 11 78466889 missense probably benign 0.05
R4682:Slc46a1 UTSW 11 78468676 missense possibly damaging 0.85
R5513:Slc46a1 UTSW 11 78466550 missense probably benign 0.38
R5739:Slc46a1 UTSW 11 78467149 missense possibly damaging 0.95
R6033:Slc46a1 UTSW 11 78466007 critical splice donor site probably null
R6033:Slc46a1 UTSW 11 78466007 critical splice donor site probably null
R6351:Slc46a1 UTSW 11 78467159 missense probably benign 0.13
R6807:Slc46a1 UTSW 11 78466964 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTTATGCCAACCCCTTCTGG -3'
(R):5'- GTTGAAAGCCAGGCCAATCTC -3'

Sequencing Primer
(F):5'- GATTGTCATGGCTCTATACGCAGC -3'
(R):5'- ATCTCAGCCACCCAGGTGTC -3'
Posted On2018-10-18