Incidental Mutation 'R6884:Aamp'
ID536823
Institutional Source Beutler Lab
Gene Symbol Aamp
Ensembl Gene ENSMUSG00000006299
Gene Nameangio-associated migratory protein
SynonymsAamp-rs
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R6884 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location74279840-74284738 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 74284248 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006462] [ENSMUST00000016309] [ENSMUST00000027370] [ENSMUST00000077985] [ENSMUST00000087226] [ENSMUST00000113796] [ENSMUST00000113805] [ENSMUST00000178235] [ENSMUST00000187046] [ENSMUST00000190008]
Predicted Effect probably benign
Transcript: ENSMUST00000006462
SMART Domains Protein: ENSMUSP00000006462
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 34 42 N/A INTRINSIC
low complexity region 46 64 N/A INTRINSIC
WD40 81 121 2.76e-2 SMART
WD40 124 163 4.83e-7 SMART
WD40 166 203 7.96e0 SMART
WD40 205 244 2.51e-5 SMART
WD40 247 289 2.38e-6 SMART
WD40 292 346 2.47e1 SMART
WD40 349 387 2.61e-3 SMART
WD40 390 429 1.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000016309
SMART Domains Protein: ENSMUSP00000016309
Gene: ENSMUSG00000006301

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
Pfam:Bax1-I 94 305 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000027370
SMART Domains Protein: ENSMUSP00000027370
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
Blast:Lactamase_B 4 79 1e-24 BLAST
Lactamase_B 129 291 1.05e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077985
SMART Domains Protein: ENSMUSP00000077135
Gene: ENSMUSG00000064272

DomainStartEndE-ValueType
Pfam:7tm_1 30 264 7.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087226
SMART Domains Protein: ENSMUSP00000084478
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
low complexity region 43 61 N/A INTRINSIC
Pfam:DUF4748 71 121 2.9e-23 PFAM
Lactamase_B 168 330 1.05e-31 SMART
Pfam:HAGH_C 331 421 6.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113796
SMART Domains Protein: ENSMUSP00000109427
Gene: ENSMUSG00000006301

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
Pfam:Bax1-I 94 305 4.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113805
SMART Domains Protein: ENSMUSP00000109436
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
Blast:Lactamase_B 4 79 4e-28 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000178235
SMART Domains Protein: ENSMUSP00000136644
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 47 65 N/A INTRINSIC
WD40 82 122 2.76e-2 SMART
WD40 125 164 4.83e-7 SMART
WD40 167 204 7.96e0 SMART
WD40 206 245 2.51e-5 SMART
WD40 248 290 2.38e-6 SMART
WD40 293 347 2.47e1 SMART
WD40 350 388 2.61e-3 SMART
WD40 391 430 1.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187046
SMART Domains Protein: ENSMUSP00000139411
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
WD40 20 60 1.7e-4 SMART
WD40 63 102 3e-9 SMART
WD40 120 160 1.7e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000190008
AA Change: V10A
SMART Domains Protein: ENSMUSP00000140427
Gene: ENSMUSG00000006299
AA Change: V10A

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
low complexity region 40 58 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the immunoglobulin superfamily. The encoded protein is associated with angiogenesis, with potential roles in endothelial tube formation and the migration of endothelial cells. It may also regulate smooth muscle cell migration via the RhoA pathway. The encoded protein can bind to heparin and may mediate heparin-sensitive cell adhesion. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 C T 11: 110,329,217 V8M probably damaging Het
Ahnak2 A T 12: 112,775,429 D736E possibly damaging Het
AI481877 A G 4: 59,059,652 S1003P possibly damaging Het
Brpf3 A G 17: 28,831,350 D1072G probably benign Het
Cacna1i C T 15: 80,374,809 R1240C probably damaging Het
Ccdc40 A T 11: 119,242,739 E568D possibly damaging Het
Col12a1 C T 9: 79,639,809 G2247E possibly damaging Het
Dapk3 T A 10: 81,191,754 probably null Het
Dcaf13 T C 15: 39,123,240 W136R probably damaging Het
Dip2a C A 10: 76,272,532 probably null Het
Eif3c T C 7: 126,556,879 D473G probably benign Het
Erich2 G A 2: 70,509,161 R20H possibly damaging Het
Gcnt7 T C 2: 172,454,205 N233S probably damaging Het
Gdpd4 G T 7: 97,972,175 L208F probably damaging Het
Gm10269 T A 18: 20,682,875 Q30L possibly damaging Het
Gm7298 A T 6: 121,760,521 I295F possibly damaging Het
Htr7 A G 19: 35,964,379 probably null Het
Ing1 A G 8: 11,561,916 Y118C probably damaging Het
Krtap16-1 C T 11: 99,986,458 W40* probably null Het
Krtap26-1 A T 16: 88,647,579 D51E probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp1 T A 10: 127,559,117 Q2513L probably benign Het
Morf4l1 A T 9: 90,094,479 N265K probably damaging Het
Mpp2 T C 11: 102,062,078 D299G probably benign Het
Mtcl1 C T 17: 66,438,202 G55R probably damaging Het
Myb T A 10: 21,152,532 K144I probably damaging Het
Myo18a T C 11: 77,819,049 I587T possibly damaging Het
Nr2c2 A G 6: 92,158,393 S288G probably benign Het
Obscn A G 11: 59,078,302 Y2700H probably damaging Het
Olfr373 T C 8: 72,100,501 V247A probably benign Het
Olfr788 T A 10: 129,473,154 F154Y probably damaging Het
Pde6b A G 5: 108,388,708 D90G probably damaging Het
Pigo A G 4: 43,022,627 F315L possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ret T C 6: 118,155,401 D1026G probably damaging Het
Rptn A T 3: 93,395,789 Q143L probably benign Het
Rubcnl A G 14: 75,035,470 E210G probably benign Het
Serpina1b T A 12: 103,732,453 T46S probably benign Het
Serpinb9e A T 13: 33,251,626 H14L probably benign Het
Slc25a25 A C 2: 32,420,662 V168G probably benign Het
Slc35e1 T C 8: 72,484,882 T261A possibly damaging Het
Spocd1 T C 4: 129,955,404 probably benign Het
Tmem222 A T 4: 133,268,203 Y178N probably damaging Het
Top1mt C T 15: 75,664,044 E470K probably benign Het
Traj42 T C 14: 54,175,833 probably benign Het
Tshr T C 12: 91,538,102 Y13H probably damaging Het
Uvssa A G 5: 33,409,117 probably null Het
Vmn1r28 G A 6: 58,265,648 V159I probably benign Het
Vmn2r73 T A 7: 85,858,005 T700S probably benign Het
Other mutations in Aamp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Aamp APN 1 74281436 unclassified probably benign
IGL02476:Aamp APN 1 74281524 unclassified probably benign
R0960:Aamp UTSW 1 74281145 missense possibly damaging 0.77
R1590:Aamp UTSW 1 74283211 missense probably damaging 1.00
R2138:Aamp UTSW 1 74283963 missense probably benign 0.00
R4112:Aamp UTSW 1 74281227 unclassified probably benign
R4223:Aamp UTSW 1 74281126 missense probably damaging 0.98
R5049:Aamp UTSW 1 74282539 missense probably damaging 1.00
R5283:Aamp UTSW 1 74284006 missense possibly damaging 0.49
R6353:Aamp UTSW 1 74280828 missense probably benign 0.37
R6526:Aamp UTSW 1 74284172 critical splice donor site probably null
R6683:Aamp UTSW 1 74282445 missense possibly damaging 0.76
R7141:Aamp UTSW 1 74284111 intron probably null
Predicted Primers PCR Primer
(F):5'- AAGCGTTAAAAGATGGAGCTCC -3'
(R):5'- TGAGAACTGACGCTCCTGAG -3'

Sequencing Primer
(F):5'- TGGAGCTCCAAAGATAATACAAGG -3'
(R):5'- GGACAAGAGGCGCTCAC -3'
Posted On2018-10-18