Incidental Mutation 'R6884:Rptn'
ID536829
Institutional Source Beutler Lab
Gene Symbol Rptn
Ensembl Gene ENSMUSG00000041984
Gene Namerepetin
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_009100; MGI: 1099055

Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6884 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location93393699-93399442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93395789 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 143 (Q143L)
Ref Sequence ENSEMBL: ENSMUSP00000044998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045912]
Predicted Effect probably benign
Transcript: ENSMUST00000045912
AA Change: Q143L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044998
Gene: ENSMUSG00000041984
AA Change: Q143L

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.2e-13 PFAM
Blast:EFh 53 81 5e-10 BLAST
low complexity region 189 204 N/A INTRINSIC
low complexity region 237 252 N/A INTRINSIC
Blast:CTD 318 461 1e-7 BLAST
low complexity region 1007 1041 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,248 probably benign Het
Abca5 C T 11: 110,329,217 V8M probably damaging Het
Ahnak2 A T 12: 112,775,429 D736E possibly damaging Het
AI481877 A G 4: 59,059,652 S1003P possibly damaging Het
Brpf3 A G 17: 28,831,350 D1072G probably benign Het
Cacna1i C T 15: 80,374,809 R1240C probably damaging Het
Ccdc40 A T 11: 119,242,739 E568D possibly damaging Het
Col12a1 C T 9: 79,639,809 G2247E possibly damaging Het
Dapk3 T A 10: 81,191,754 probably null Het
Dcaf13 T C 15: 39,123,240 W136R probably damaging Het
Dip2a C A 10: 76,272,532 probably null Het
Eif3c T C 7: 126,556,879 D473G probably benign Het
Erich2 G A 2: 70,509,161 R20H possibly damaging Het
Gcnt7 T C 2: 172,454,205 N233S probably damaging Het
Gdpd4 G T 7: 97,972,175 L208F probably damaging Het
Gm10269 T A 18: 20,682,875 Q30L possibly damaging Het
Gm7298 A T 6: 121,760,521 I295F possibly damaging Het
Htr7 A G 19: 35,964,379 probably null Het
Ing1 A G 8: 11,561,916 Y118C probably damaging Het
Krtap16-1 C T 11: 99,986,458 W40* probably null Het
Krtap26-1 A T 16: 88,647,579 D51E probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp1 T A 10: 127,559,117 Q2513L probably benign Het
Morf4l1 A T 9: 90,094,479 N265K probably damaging Het
Mpp2 T C 11: 102,062,078 D299G probably benign Het
Mtcl1 C T 17: 66,438,202 G55R probably damaging Het
Myb T A 10: 21,152,532 K144I probably damaging Het
Myo18a T C 11: 77,819,049 I587T possibly damaging Het
Nr2c2 A G 6: 92,158,393 S288G probably benign Het
Obscn A G 11: 59,078,302 Y2700H probably damaging Het
Olfr373 T C 8: 72,100,501 V247A probably benign Het
Olfr788 T A 10: 129,473,154 F154Y probably damaging Het
Pde6b A G 5: 108,388,708 D90G probably damaging Het
Pigo A G 4: 43,022,627 F315L possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ret T C 6: 118,155,401 D1026G probably damaging Het
Rubcnl A G 14: 75,035,470 E210G probably benign Het
Serpina1b T A 12: 103,732,453 T46S probably benign Het
Serpinb9e A T 13: 33,251,626 H14L probably benign Het
Slc25a25 A C 2: 32,420,662 V168G probably benign Het
Slc35e1 T C 8: 72,484,882 T261A possibly damaging Het
Spocd1 T C 4: 129,955,404 probably benign Het
Tmem222 A T 4: 133,268,203 Y178N probably damaging Het
Top1mt C T 15: 75,664,044 E470K probably benign Het
Traj42 T C 14: 54,175,833 probably benign Het
Tshr T C 12: 91,538,102 Y13H probably damaging Het
Uvssa A G 5: 33,409,117 probably null Het
Vmn1r28 G A 6: 58,265,648 V159I probably benign Het
Vmn2r73 T A 7: 85,858,005 T700S probably benign Het
Other mutations in Rptn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Rptn APN 3 93397182 missense probably benign
IGL01070:Rptn APN 3 93398176 missense possibly damaging 0.86
IGL01625:Rptn APN 3 93397894 missense probably benign 0.18
IGL01678:Rptn APN 3 93396811 missense probably benign 0.00
IGL01716:Rptn APN 3 93396710 missense possibly damaging 0.53
IGL01767:Rptn APN 3 93395639 missense probably benign 0.00
IGL01872:Rptn APN 3 93396847 missense probably benign
IGL02000:Rptn APN 3 93396428 missense probably benign 0.01
IGL02066:Rptn APN 3 93397129 missense probably benign 0.01
IGL02090:Rptn APN 3 93396734 missense possibly damaging 0.85
IGL02116:Rptn APN 3 93395097 missense possibly damaging 0.88
IGL02216:Rptn APN 3 93395773 missense possibly damaging 0.73
IGL02368:Rptn APN 3 93397171 missense probably benign 0.18
IGL02820:Rptn APN 3 93396920 missense probably benign 0.01
IGL03323:Rptn APN 3 93397153 missense probably benign
IGL03404:Rptn APN 3 93398129 missense possibly damaging 0.53
D3080:Rptn UTSW 3 93395828 missense possibly damaging 0.85
H8786:Rptn UTSW 3 93397873 missense possibly damaging 0.53
IGL03097:Rptn UTSW 3 93397373 missense probably damaging 1.00
LCD18:Rptn UTSW 3 93397541 missense probably benign
PIT4431001:Rptn UTSW 3 93397397 small deletion probably benign
PIT4480001:Rptn UTSW 3 93397670 missense possibly damaging 0.85
R1024:Rptn UTSW 3 93398225 missense possibly damaging 0.72
R1119:Rptn UTSW 3 93396245 missense possibly damaging 0.96
R1727:Rptn UTSW 3 93397138 missense possibly damaging 0.73
R1901:Rptn UTSW 3 93396710 missense possibly damaging 0.53
R2247:Rptn UTSW 3 93396829 missense probably benign
R2921:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2922:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2923:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R3901:Rptn UTSW 3 93398357 missense probably benign
R3936:Rptn UTSW 3 93395576 missense possibly damaging 0.79
R4304:Rptn UTSW 3 93396931 missense probably benign 0.33
R4491:Rptn UTSW 3 93396511 nonsense probably null
R4654:Rptn UTSW 3 93397485 missense possibly damaging 0.53
R4870:Rptn UTSW 3 93396469 nonsense probably null
R5246:Rptn UTSW 3 93396833 missense probably damaging 0.98
R5246:Rptn UTSW 3 93397729 missense possibly damaging 0.53
R5544:Rptn UTSW 3 93398473 missense possibly damaging 0.53
R5555:Rptn UTSW 3 93396701 missense probably benign
R5896:Rptn UTSW 3 93398332 nonsense probably null
R5956:Rptn UTSW 3 93398027 missense possibly damaging 0.53
R6192:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6209:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6224:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6226:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6227:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6230:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6247:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6258:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6393:Rptn UTSW 3 93397199 missense probably benign
R6513:Rptn UTSW 3 93396112 missense possibly damaging 0.73
R6854:Rptn UTSW 3 93398123 missense possibly damaging 0.53
R6855:Rptn UTSW 3 93398251 missense probably benign 0.33
R7018:Rptn UTSW 3 93397900 missense possibly damaging 0.73
R7241:Rptn UTSW 3 93395954 missense probably benign 0.01
R7337:Rptn UTSW 3 93396905 missense probably benign 0.03
X0018:Rptn UTSW 3 93395941 nonsense probably null
Z1088:Rptn UTSW 3 93397427 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCTGCCATCATAAGCTAGATAG -3'
(R):5'- ACCTTTGGGCTGTTCATGAC -3'

Sequencing Primer
(F):5'- GTAAGTTCTATGGATCTAGAACCTCC -3'
(R):5'- CCCAGTCTTTGACTAGAACTAGAAG -3'
Posted On2018-10-18