Incidental Mutation 'R6884:Tmem222'
ID536833
Institutional Source Beutler Lab
Gene Symbol Tmem222
Ensembl Gene ENSMUSG00000028857
Gene Nametransmembrane protein 222
Synonyms5730406H10Rik, D4Ertd196e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R6884 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location133266045-133277792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 133268203 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 178 (Y178N)
Ref Sequence ENSEMBL: ENSMUSP00000101527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105907] [ENSMUST00000139030]
Predicted Effect probably damaging
Transcript: ENSMUST00000105907
AA Change: Y178N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101527
Gene: ENSMUSG00000028857
AA Change: Y178N

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:DUF778 61 118 4.4e-28 PFAM
Pfam:DUF778 112 178 3.2e-22 PFAM
transmembrane domain 188 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134781
SMART Domains Protein: ENSMUSP00000120532
Gene: ENSMUSG00000028857

DomainStartEndE-ValueType
Pfam:DUF778 26 66 2.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137622
SMART Domains Protein: ENSMUSP00000117527
Gene: ENSMUSG00000028857

DomainStartEndE-ValueType
Pfam:DUF778 41 96 2.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139030
SMART Domains Protein: ENSMUSP00000121858
Gene: ENSMUSG00000028857

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,248 probably benign Het
Abca5 C T 11: 110,329,217 V8M probably damaging Het
Ahnak2 A T 12: 112,775,429 D736E possibly damaging Het
AI481877 A G 4: 59,059,652 S1003P possibly damaging Het
Brpf3 A G 17: 28,831,350 D1072G probably benign Het
Cacna1i C T 15: 80,374,809 R1240C probably damaging Het
Ccdc40 A T 11: 119,242,739 E568D possibly damaging Het
Col12a1 C T 9: 79,639,809 G2247E possibly damaging Het
Dapk3 T A 10: 81,191,754 probably null Het
Dcaf13 T C 15: 39,123,240 W136R probably damaging Het
Dip2a C A 10: 76,272,532 probably null Het
Eif3c T C 7: 126,556,879 D473G probably benign Het
Erich2 G A 2: 70,509,161 R20H possibly damaging Het
Gcnt7 T C 2: 172,454,205 N233S probably damaging Het
Gdpd4 G T 7: 97,972,175 L208F probably damaging Het
Gm10269 T A 18: 20,682,875 Q30L possibly damaging Het
Gm7298 A T 6: 121,760,521 I295F possibly damaging Het
Htr7 A G 19: 35,964,379 probably null Het
Ing1 A G 8: 11,561,916 Y118C probably damaging Het
Krtap16-1 C T 11: 99,986,458 W40* probably null Het
Krtap26-1 A T 16: 88,647,579 D51E probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp1 T A 10: 127,559,117 Q2513L probably benign Het
Morf4l1 A T 9: 90,094,479 N265K probably damaging Het
Mpp2 T C 11: 102,062,078 D299G probably benign Het
Mtcl1 C T 17: 66,438,202 G55R probably damaging Het
Myb T A 10: 21,152,532 K144I probably damaging Het
Myo18a T C 11: 77,819,049 I587T possibly damaging Het
Nr2c2 A G 6: 92,158,393 S288G probably benign Het
Obscn A G 11: 59,078,302 Y2700H probably damaging Het
Olfr373 T C 8: 72,100,501 V247A probably benign Het
Olfr788 T A 10: 129,473,154 F154Y probably damaging Het
Pde6b A G 5: 108,388,708 D90G probably damaging Het
Pigo A G 4: 43,022,627 F315L possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ret T C 6: 118,155,401 D1026G probably damaging Het
Rptn A T 3: 93,395,789 Q143L probably benign Het
Rubcnl A G 14: 75,035,470 E210G probably benign Het
Serpina1b T A 12: 103,732,453 T46S probably benign Het
Serpinb9e A T 13: 33,251,626 H14L probably benign Het
Slc25a25 A C 2: 32,420,662 V168G probably benign Het
Slc35e1 T C 8: 72,484,882 T261A possibly damaging Het
Spocd1 T C 4: 129,955,404 probably benign Het
Top1mt C T 15: 75,664,044 E470K probably benign Het
Traj42 T C 14: 54,175,833 probably benign Het
Tshr T C 12: 91,538,102 Y13H probably damaging Het
Uvssa A G 5: 33,409,117 probably null Het
Vmn1r28 G A 6: 58,265,648 V159I probably benign Het
Vmn2r73 T A 7: 85,858,005 T700S probably benign Het
Other mutations in Tmem222
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0496:Tmem222 UTSW 4 133277591 missense possibly damaging 0.66
R2408:Tmem222 UTSW 4 133271024 missense possibly damaging 0.54
R4726:Tmem222 UTSW 4 133277664 missense probably benign 0.27
R5330:Tmem222 UTSW 4 133277624 missense possibly damaging 0.83
R6239:Tmem222 UTSW 4 133268295 missense probably damaging 1.00
R6803:Tmem222 UTSW 4 133266843 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTAAGCAGTGACAAGCCAGC -3'
(R):5'- TCCGAAGAGTATAAGCACCGAATG -3'

Sequencing Primer
(F):5'- TGACAAGCCAGCAGGGAAC -3'
(R):5'- CTCAGGGGGTCTGTGTGCC -3'
Posted On2018-10-18