Incidental Mutation 'R6884:Uvssa'
ID536834
Institutional Source Beutler Lab
Gene Symbol Uvssa
Ensembl Gene ENSMUSG00000037355
Gene NameUV stimulated scaffold protein A
SynonymsD330017J19Rik, 4933407H18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R6884 (G1)
Quality Score142.008
Status Not validated
Chromosome5
Chromosomal Location33378549-33419754 bp(+) (GRCm38)
Type of Mutationintron (137 bp from exon)
DNA Base Change (assembly) A to G at 33409117 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087864] [ENSMUST00000202046] [ENSMUST00000202816]
Predicted Effect probably null
Transcript: ENSMUST00000087864
SMART Domains Protein: ENSMUSP00000085170
Gene: ENSMUSG00000037355

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
Pfam:DUF2043 504 610 6e-43 PFAM
low complexity region 613 625 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202046
SMART Domains Protein: ENSMUSP00000144025
Gene: ENSMUSG00000037355

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202816
SMART Domains Protein: ENSMUSP00000144400
Gene: ENSMUSG00000037355

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
Pfam:DUF2043 504 610 6e-43 PFAM
low complexity region 613 625 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be involved in ubiquitination and dephosphorylation of RNA polymerase II subunits that stall after UV irradiation. The encoded protein interacts with several members of the nucleotide excision repair complex, and is thought to be involved in the transcription-coupled nucleotide excision repair (TC-NER) pathway to help remove lesions in the DNA that block transcription. Defects in this gene can cause UV-sensitive syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,248 probably benign Het
Abca5 C T 11: 110,329,217 V8M probably damaging Het
Ahnak2 A T 12: 112,775,429 D736E possibly damaging Het
AI481877 A G 4: 59,059,652 S1003P possibly damaging Het
Brpf3 A G 17: 28,831,350 D1072G probably benign Het
Cacna1i C T 15: 80,374,809 R1240C probably damaging Het
Ccdc40 A T 11: 119,242,739 E568D possibly damaging Het
Col12a1 C T 9: 79,639,809 G2247E possibly damaging Het
Dapk3 T A 10: 81,191,754 probably null Het
Dcaf13 T C 15: 39,123,240 W136R probably damaging Het
Dip2a C A 10: 76,272,532 probably null Het
Eif3c T C 7: 126,556,879 D473G probably benign Het
Erich2 G A 2: 70,509,161 R20H possibly damaging Het
Gcnt7 T C 2: 172,454,205 N233S probably damaging Het
Gdpd4 G T 7: 97,972,175 L208F probably damaging Het
Gm10269 T A 18: 20,682,875 Q30L possibly damaging Het
Gm7298 A T 6: 121,760,521 I295F possibly damaging Het
Htr7 A G 19: 35,964,379 probably null Het
Ing1 A G 8: 11,561,916 Y118C probably damaging Het
Krtap16-1 C T 11: 99,986,458 W40* probably null Het
Krtap26-1 A T 16: 88,647,579 D51E probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp1 T A 10: 127,559,117 Q2513L probably benign Het
Morf4l1 A T 9: 90,094,479 N265K probably damaging Het
Mpp2 T C 11: 102,062,078 D299G probably benign Het
Mtcl1 C T 17: 66,438,202 G55R probably damaging Het
Myb T A 10: 21,152,532 K144I probably damaging Het
Myo18a T C 11: 77,819,049 I587T possibly damaging Het
Nr2c2 A G 6: 92,158,393 S288G probably benign Het
Obscn A G 11: 59,078,302 Y2700H probably damaging Het
Olfr373 T C 8: 72,100,501 V247A probably benign Het
Olfr788 T A 10: 129,473,154 F154Y probably damaging Het
Pde6b A G 5: 108,388,708 D90G probably damaging Het
Pigo A G 4: 43,022,627 F315L possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ret T C 6: 118,155,401 D1026G probably damaging Het
Rptn A T 3: 93,395,789 Q143L probably benign Het
Rubcnl A G 14: 75,035,470 E210G probably benign Het
Serpina1b T A 12: 103,732,453 T46S probably benign Het
Serpinb9e A T 13: 33,251,626 H14L probably benign Het
Slc25a25 A C 2: 32,420,662 V168G probably benign Het
Slc35e1 T C 8: 72,484,882 T261A possibly damaging Het
Spocd1 T C 4: 129,955,404 probably benign Het
Tmem222 A T 4: 133,268,203 Y178N probably damaging Het
Top1mt C T 15: 75,664,044 E470K probably benign Het
Traj42 T C 14: 54,175,833 probably benign Het
Tshr T C 12: 91,538,102 Y13H probably damaging Het
Vmn1r28 G A 6: 58,265,648 V159I probably benign Het
Vmn2r73 T A 7: 85,858,005 T700S probably benign Het
Other mutations in Uvssa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Uvssa APN 5 33408848 missense probably benign 0.00
IGL02136:Uvssa APN 5 33391848 missense probably damaging 1.00
IGL02339:Uvssa APN 5 33414849 missense probably damaging 1.00
IGL03096:Uvssa APN 5 33410924 missense probably benign 0.29
IGL03130:Uvssa APN 5 33391845 missense possibly damaging 0.57
IGL03248:Uvssa APN 5 33391816 missense probably damaging 1.00
PIT1430001:Uvssa UTSW 5 33402570 missense possibly damaging 0.50
PIT4142001:Uvssa UTSW 5 33392084 missense probably benign 0.05
R0326:Uvssa UTSW 5 33408847 missense probably benign 0.01
R0443:Uvssa UTSW 5 33388824 missense possibly damaging 0.68
R1438:Uvssa UTSW 5 33413884 splice site probably benign
R1474:Uvssa UTSW 5 33388821 missense probably benign 0.00
R1521:Uvssa UTSW 5 33413934 missense probably damaging 0.99
R1522:Uvssa UTSW 5 33387808 missense probably damaging 1.00
R1839:Uvssa UTSW 5 33389752 missense probably benign 0.00
R2223:Uvssa UTSW 5 33392063 missense probably damaging 1.00
R3404:Uvssa UTSW 5 33389818 missense probably damaging 0.99
R3405:Uvssa UTSW 5 33389818 missense probably damaging 0.99
R3406:Uvssa UTSW 5 33389818 missense probably damaging 0.99
R3892:Uvssa UTSW 5 33389752 missense probably benign 0.04
R4624:Uvssa UTSW 5 33389956 missense possibly damaging 0.87
R4898:Uvssa UTSW 5 33413913 nonsense probably null
R5413:Uvssa UTSW 5 33410908 missense probably damaging 1.00
R5921:Uvssa UTSW 5 33389752 missense probably benign 0.00
R5977:Uvssa UTSW 5 33389860 missense probably damaging 1.00
R6198:Uvssa UTSW 5 33409510 missense probably damaging 1.00
R6566:Uvssa UTSW 5 33392176 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GCTCCAGGACTGCTTATCATC -3'
(R):5'- TTCAGAAGCCTGGGATCAGC -3'

Sequencing Primer
(F):5'- AGGACTGCTTATCATCTCCCTC -3'
(R):5'- ATACTACATTGGGCCTGAGC -3'
Posted On2018-10-18