Incidental Mutation 'R6884:Olfr788'
ID536852
Institutional Source Beutler Lab
Gene Symbol Olfr788
Ensembl Gene ENSMUSG00000049217
Gene Nameolfactory receptor 788
SynonymsMOR111-4, GA_x6K02T2PULF-11151514-11152449
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6884 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location129470998-129476618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129473154 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 154 (F154Y)
Ref Sequence ENSEMBL: ENSMUSP00000151054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056961] [ENSMUST00000213222]
Predicted Effect probably damaging
Transcript: ENSMUST00000056961
AA Change: F154Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054710
Gene: ENSMUSG00000049217
AA Change: F154Y

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.8e-49 PFAM
Pfam:7tm_1 38 287 1.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213222
AA Change: F154Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,248 probably benign Het
Abca5 C T 11: 110,329,217 V8M probably damaging Het
Ahnak2 A T 12: 112,775,429 D736E possibly damaging Het
AI481877 A G 4: 59,059,652 S1003P possibly damaging Het
Brpf3 A G 17: 28,831,350 D1072G probably benign Het
Cacna1i C T 15: 80,374,809 R1240C probably damaging Het
Ccdc40 A T 11: 119,242,739 E568D possibly damaging Het
Col12a1 C T 9: 79,639,809 G2247E possibly damaging Het
Dapk3 T A 10: 81,191,754 probably null Het
Dcaf13 T C 15: 39,123,240 W136R probably damaging Het
Dip2a C A 10: 76,272,532 probably null Het
Eif3c T C 7: 126,556,879 D473G probably benign Het
Erich2 G A 2: 70,509,161 R20H possibly damaging Het
Gcnt7 T C 2: 172,454,205 N233S probably damaging Het
Gdpd4 G T 7: 97,972,175 L208F probably damaging Het
Gm10269 T A 18: 20,682,875 Q30L possibly damaging Het
Gm7298 A T 6: 121,760,521 I295F possibly damaging Het
Htr7 A G 19: 35,964,379 probably null Het
Ing1 A G 8: 11,561,916 Y118C probably damaging Het
Krtap16-1 C T 11: 99,986,458 W40* probably null Het
Krtap26-1 A T 16: 88,647,579 D51E probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp1 T A 10: 127,559,117 Q2513L probably benign Het
Morf4l1 A T 9: 90,094,479 N265K probably damaging Het
Mpp2 T C 11: 102,062,078 D299G probably benign Het
Mtcl1 C T 17: 66,438,202 G55R probably damaging Het
Myb T A 10: 21,152,532 K144I probably damaging Het
Myo18a T C 11: 77,819,049 I587T possibly damaging Het
Nr2c2 A G 6: 92,158,393 S288G probably benign Het
Obscn A G 11: 59,078,302 Y2700H probably damaging Het
Olfr373 T C 8: 72,100,501 V247A probably benign Het
Pde6b A G 5: 108,388,708 D90G probably damaging Het
Pigo A G 4: 43,022,627 F315L possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ret T C 6: 118,155,401 D1026G probably damaging Het
Rptn A T 3: 93,395,789 Q143L probably benign Het
Rubcnl A G 14: 75,035,470 E210G probably benign Het
Serpina1b T A 12: 103,732,453 T46S probably benign Het
Serpinb9e A T 13: 33,251,626 H14L probably benign Het
Slc25a25 A C 2: 32,420,662 V168G probably benign Het
Slc35e1 T C 8: 72,484,882 T261A possibly damaging Het
Spocd1 T C 4: 129,955,404 probably benign Het
Tmem222 A T 4: 133,268,203 Y178N probably damaging Het
Top1mt C T 15: 75,664,044 E470K probably benign Het
Traj42 T C 14: 54,175,833 probably benign Het
Tshr T C 12: 91,538,102 Y13H probably damaging Het
Uvssa A G 5: 33,409,117 probably null Het
Vmn1r28 G A 6: 58,265,648 V159I probably benign Het
Vmn2r73 T A 7: 85,858,005 T700S probably benign Het
Other mutations in Olfr788
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Olfr788 APN 10 129473211 missense probably damaging 1.00
IGL02393:Olfr788 APN 10 129473195 missense probably damaging 1.00
IGL03010:Olfr788 APN 10 129472974 missense probably damaging 1.00
IGL03325:Olfr788 APN 10 129473605 missense probably benign 0.02
R1298:Olfr788 UTSW 10 129473064 missense probably damaging 1.00
R2215:Olfr788 UTSW 10 129473420 missense probably damaging 0.99
R5482:Olfr788 UTSW 10 129473078 missense probably benign 0.31
R5699:Olfr788 UTSW 10 129472877 missense probably damaging 1.00
R5794:Olfr788 UTSW 10 129473426 missense possibly damaging 0.95
R6436:Olfr788 UTSW 10 129472904 missense probably damaging 0.98
R6480:Olfr788 UTSW 10 129472721 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TAACAACTGTGCTGCCCAAC -3'
(R):5'- CGCTGGCTGGTAGATGGAATTC -3'

Sequencing Primer
(F):5'- AACTGTGCTGCCCAACTCTTTTTC -3'
(R):5'- AGATAAAATCACCAATGCCAAAGTG -3'
Posted On2018-10-18