Incidental Mutation 'R6884:Mpp2'
ID536856
Institutional Source Beutler Lab
Gene Symbol Mpp2
Ensembl Gene ENSMUSG00000017314
Gene Namemembrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
SynonymsDlg2, Dlgh2, Pals4, D11Bwg0652e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6884 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location102057015-102088515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102062078 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 299 (D299G)
Ref Sequence ENSEMBL: ENSMUSP00000017458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017458] [ENSMUST00000100398]
Predicted Effect probably benign
Transcript: ENSMUST00000017458
AA Change: D299G

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000017458
Gene: ENSMUSG00000017314
AA Change: D299G

DomainStartEndE-ValueType
L27 11 66 1.19e-11 SMART
L27 67 121 2.46e-13 SMART
PDZ 149 219 1.89e-10 SMART
SH3 228 292 9.77e-11 SMART
GuKc 349 540 6.55e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100398
AA Change: D316G

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097967
Gene: ENSMUSG00000017314
AA Change: D316G

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
L27 28 83 1.19e-11 SMART
L27 84 138 2.46e-13 SMART
PDZ 166 236 1.89e-10 SMART
SH3 245 309 9.77e-11 SMART
GuKc 366 557 6.55e-79 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Palmitoylated membrane protein 2 is a member of a family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologs). MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intracellular junctions. Palmitoylated membrane protein 2 contains a conserved sequence, called the SH3 (src homology 3) motif, found in several other proteins that associate with the cytoskeleton and are suspected to play important roles in signal transduction. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,248 probably benign Het
Abca5 C T 11: 110,329,217 V8M probably damaging Het
Ahnak2 A T 12: 112,775,429 D736E possibly damaging Het
AI481877 A G 4: 59,059,652 S1003P possibly damaging Het
Brpf3 A G 17: 28,831,350 D1072G probably benign Het
Cacna1i C T 15: 80,374,809 R1240C probably damaging Het
Ccdc40 A T 11: 119,242,739 E568D possibly damaging Het
Col12a1 C T 9: 79,639,809 G2247E possibly damaging Het
Dapk3 T A 10: 81,191,754 probably null Het
Dcaf13 T C 15: 39,123,240 W136R probably damaging Het
Dip2a C A 10: 76,272,532 probably null Het
Eif3c T C 7: 126,556,879 D473G probably benign Het
Erich2 G A 2: 70,509,161 R20H possibly damaging Het
Gcnt7 T C 2: 172,454,205 N233S probably damaging Het
Gdpd4 G T 7: 97,972,175 L208F probably damaging Het
Gm10269 T A 18: 20,682,875 Q30L possibly damaging Het
Gm7298 A T 6: 121,760,521 I295F possibly damaging Het
Htr7 A G 19: 35,964,379 probably null Het
Ing1 A G 8: 11,561,916 Y118C probably damaging Het
Krtap16-1 C T 11: 99,986,458 W40* probably null Het
Krtap26-1 A T 16: 88,647,579 D51E probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp1 T A 10: 127,559,117 Q2513L probably benign Het
Morf4l1 A T 9: 90,094,479 N265K probably damaging Het
Mtcl1 C T 17: 66,438,202 G55R probably damaging Het
Myb T A 10: 21,152,532 K144I probably damaging Het
Myo18a T C 11: 77,819,049 I587T possibly damaging Het
Nr2c2 A G 6: 92,158,393 S288G probably benign Het
Obscn A G 11: 59,078,302 Y2700H probably damaging Het
Olfr373 T C 8: 72,100,501 V247A probably benign Het
Olfr788 T A 10: 129,473,154 F154Y probably damaging Het
Pde6b A G 5: 108,388,708 D90G probably damaging Het
Pigo A G 4: 43,022,627 F315L possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ret T C 6: 118,155,401 D1026G probably damaging Het
Rptn A T 3: 93,395,789 Q143L probably benign Het
Rubcnl A G 14: 75,035,470 E210G probably benign Het
Serpina1b T A 12: 103,732,453 T46S probably benign Het
Serpinb9e A T 13: 33,251,626 H14L probably benign Het
Slc25a25 A C 2: 32,420,662 V168G probably benign Het
Slc35e1 T C 8: 72,484,882 T261A possibly damaging Het
Spocd1 T C 4: 129,955,404 probably benign Het
Tmem222 A T 4: 133,268,203 Y178N probably damaging Het
Top1mt C T 15: 75,664,044 E470K probably benign Het
Traj42 T C 14: 54,175,833 probably benign Het
Tshr T C 12: 91,538,102 Y13H probably damaging Het
Uvssa A G 5: 33,409,117 probably null Het
Vmn1r28 G A 6: 58,265,648 V159I probably benign Het
Vmn2r73 T A 7: 85,858,005 T700S probably benign Het
Other mutations in Mpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Mpp2 APN 11 102063309 missense probably damaging 1.00
IGL01564:Mpp2 APN 11 102061519 missense probably benign 0.01
IGL02158:Mpp2 APN 11 102063262 missense probably benign 0.01
IGL02456:Mpp2 APN 11 102059373 missense possibly damaging 0.72
IGL03271:Mpp2 APN 11 102063423 splice site probably benign
R0488:Mpp2 UTSW 11 102061601 missense possibly damaging 0.64
R0512:Mpp2 UTSW 11 102062290 missense possibly damaging 0.64
R0960:Mpp2 UTSW 11 102061585 missense possibly damaging 0.80
R1572:Mpp2 UTSW 11 102060548 missense probably benign 0.07
R1740:Mpp2 UTSW 11 102062396 splice site probably null
R1867:Mpp2 UTSW 11 102064667 missense probably benign 0.09
R2133:Mpp2 UTSW 11 102064595 missense probably benign 0.01
R2277:Mpp2 UTSW 11 102064301 missense probably damaging 0.97
R2279:Mpp2 UTSW 11 102064301 missense probably damaging 0.97
R2313:Mpp2 UTSW 11 102062072 missense possibly damaging 0.77
R2882:Mpp2 UTSW 11 102064633 missense probably benign 0.00
R3429:Mpp2 UTSW 11 102085315 missense probably benign
R4719:Mpp2 UTSW 11 102064433 missense possibly damaging 0.93
R4959:Mpp2 UTSW 11 102063291 missense probably damaging 1.00
R4968:Mpp2 UTSW 11 102064298 missense probably benign 0.31
R5715:Mpp2 UTSW 11 102062261 missense probably damaging 1.00
R5778:Mpp2 UTSW 11 102064443 missense probably benign 0.06
R6034:Mpp2 UTSW 11 102061634 missense possibly damaging 0.88
R6034:Mpp2 UTSW 11 102061634 missense possibly damaging 0.88
R6045:Mpp2 UTSW 11 102059354 missense probably benign 0.05
R6275:Mpp2 UTSW 11 102060969 missense probably damaging 1.00
R6458:Mpp2 UTSW 11 102080769 missense probably benign 0.01
R6980:Mpp2 UTSW 11 102059328 missense probably damaging 1.00
X0067:Mpp2 UTSW 11 102064385 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CACCTGCATTCTTGGTGGTC -3'
(R):5'- GGGGACTTGCTCCAGATTGTAAAC -3'

Sequencing Primer
(F):5'- GGTGGTCAAATACATCATTCGC -3'
(R):5'- GCTCCAGATTGTAAACCAAGATG -3'
Posted On2018-10-18