Incidental Mutation 'R6884:Traj42'
ID536863
Institutional Source Beutler Lab
Gene Symbol Traj42
Ensembl Gene ENSMUSG00000076888
Gene NameT cell receptor alpha joining 42
SynonymsGm16922
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6884 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location54175773-54175836 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 54175833 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect probably benign
Transcript: ENSMUST00000103696
Predicted Effect probably benign
Transcript: ENSMUST00000103697
Predicted Effect probably benign
Transcript: ENSMUST00000103698
Predicted Effect probably benign
Transcript: ENSMUST00000103699
Predicted Effect unknown
Transcript: ENSMUST00000103700
AA Change: S21P
Predicted Effect probably benign
Transcript: ENSMUST00000103701
Predicted Effect probably benign
Transcript: ENSMUST00000103702
Predicted Effect probably benign
Transcript: ENSMUST00000103703
Predicted Effect probably benign
Transcript: ENSMUST00000103704
Predicted Effect probably benign
Transcript: ENSMUST00000197949
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,248 probably benign Het
Abca5 C T 11: 110,329,217 V8M probably damaging Het
Ahnak2 A T 12: 112,775,429 D736E possibly damaging Het
AI481877 A G 4: 59,059,652 S1003P possibly damaging Het
Brpf3 A G 17: 28,831,350 D1072G probably benign Het
Cacna1i C T 15: 80,374,809 R1240C probably damaging Het
Ccdc40 A T 11: 119,242,739 E568D possibly damaging Het
Col12a1 C T 9: 79,639,809 G2247E possibly damaging Het
Dapk3 T A 10: 81,191,754 probably null Het
Dcaf13 T C 15: 39,123,240 W136R probably damaging Het
Dip2a C A 10: 76,272,532 probably null Het
Eif3c T C 7: 126,556,879 D473G probably benign Het
Erich2 G A 2: 70,509,161 R20H possibly damaging Het
Gcnt7 T C 2: 172,454,205 N233S probably damaging Het
Gdpd4 G T 7: 97,972,175 L208F probably damaging Het
Gm10269 T A 18: 20,682,875 Q30L possibly damaging Het
Gm7298 A T 6: 121,760,521 I295F possibly damaging Het
Htr7 A G 19: 35,964,379 probably null Het
Ing1 A G 8: 11,561,916 Y118C probably damaging Het
Krtap16-1 C T 11: 99,986,458 W40* probably null Het
Krtap26-1 A T 16: 88,647,579 D51E probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp1 T A 10: 127,559,117 Q2513L probably benign Het
Morf4l1 A T 9: 90,094,479 N265K probably damaging Het
Mpp2 T C 11: 102,062,078 D299G probably benign Het
Mtcl1 C T 17: 66,438,202 G55R probably damaging Het
Myb T A 10: 21,152,532 K144I probably damaging Het
Myo18a T C 11: 77,819,049 I587T possibly damaging Het
Nr2c2 A G 6: 92,158,393 S288G probably benign Het
Obscn A G 11: 59,078,302 Y2700H probably damaging Het
Olfr373 T C 8: 72,100,501 V247A probably benign Het
Olfr788 T A 10: 129,473,154 F154Y probably damaging Het
Pde6b A G 5: 108,388,708 D90G probably damaging Het
Pigo A G 4: 43,022,627 F315L possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ret T C 6: 118,155,401 D1026G probably damaging Het
Rptn A T 3: 93,395,789 Q143L probably benign Het
Rubcnl A G 14: 75,035,470 E210G probably benign Het
Serpina1b T A 12: 103,732,453 T46S probably benign Het
Serpinb9e A T 13: 33,251,626 H14L probably benign Het
Slc25a25 A C 2: 32,420,662 V168G probably benign Het
Slc35e1 T C 8: 72,484,882 T261A possibly damaging Het
Spocd1 T C 4: 129,955,404 probably benign Het
Tmem222 A T 4: 133,268,203 Y178N probably damaging Het
Top1mt C T 15: 75,664,044 E470K probably benign Het
Tshr T C 12: 91,538,102 Y13H probably damaging Het
Uvssa A G 5: 33,409,117 probably null Het
Vmn1r28 G A 6: 58,265,648 V159I probably benign Het
Vmn2r73 T A 7: 85,858,005 T700S probably benign Het
Predicted Primers PCR Primer
(F):5'- AGAGGATGCTCTAAGCCTTCC -3'
(R):5'- CAGAGTCTGCTTACACCTAGC -3'

Sequencing Primer
(F):5'- GGATGCTCTAAGCCTTCCCAGAC -3'
(R):5'- CACAGGGAAGGGCTAGCCTG -3'
Posted On2018-10-18