Incidental Mutation 'R6884:Brpf3'
ID536869
Institutional Source Beutler Lab
Gene Symbol Brpf3
Ensembl Gene ENSMUSG00000063952
Gene Namebromodomain and PHD finger containing, 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R6884 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location28801090-28838546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28831350 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1072 (D1072G)
Ref Sequence ENSEMBL: ENSMUSP00000004985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004985]
Predicted Effect probably benign
Transcript: ENSMUST00000004985
AA Change: D1072G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000004985
Gene: ENSMUSG00000063952
AA Change: D1072G

DomainStartEndE-ValueType
Pfam:EPL1 48 194 8.4e-38 PFAM
PHD 214 260 7.07e-5 SMART
PHD 324 387 4.74e-6 SMART
low complexity region 405 436 N/A INTRINSIC
Blast:BROMO 491 534 7e-21 BLAST
low complexity region 558 577 N/A INTRINSIC
BROMO 586 694 4.93e-39 SMART
low complexity region 777 792 N/A INTRINSIC
low complexity region 813 823 N/A INTRINSIC
PWWP 1073 1156 2.07e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout does not result in any obvious neurological, behavioral, developmental, histological, hematological, survival or reproductive phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,284,248 probably benign Het
Abca5 C T 11: 110,329,217 V8M probably damaging Het
Ahnak2 A T 12: 112,775,429 D736E possibly damaging Het
AI481877 A G 4: 59,059,652 S1003P possibly damaging Het
Cacna1i C T 15: 80,374,809 R1240C probably damaging Het
Ccdc40 A T 11: 119,242,739 E568D possibly damaging Het
Col12a1 C T 9: 79,639,809 G2247E possibly damaging Het
Dapk3 T A 10: 81,191,754 probably null Het
Dcaf13 T C 15: 39,123,240 W136R probably damaging Het
Dip2a C A 10: 76,272,532 probably null Het
Eif3c T C 7: 126,556,879 D473G probably benign Het
Erich2 G A 2: 70,509,161 R20H possibly damaging Het
Gcnt7 T C 2: 172,454,205 N233S probably damaging Het
Gdpd4 G T 7: 97,972,175 L208F probably damaging Het
Gm10269 T A 18: 20,682,875 Q30L possibly damaging Het
Gm7298 A T 6: 121,760,521 I295F possibly damaging Het
Htr7 A G 19: 35,964,379 probably null Het
Ing1 A G 8: 11,561,916 Y118C probably damaging Het
Krtap16-1 C T 11: 99,986,458 W40* probably null Het
Krtap26-1 A T 16: 88,647,579 D51E probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp1 T A 10: 127,559,117 Q2513L probably benign Het
Morf4l1 A T 9: 90,094,479 N265K probably damaging Het
Mpp2 T C 11: 102,062,078 D299G probably benign Het
Mtcl1 C T 17: 66,438,202 G55R probably damaging Het
Myb T A 10: 21,152,532 K144I probably damaging Het
Myo18a T C 11: 77,819,049 I587T possibly damaging Het
Nr2c2 A G 6: 92,158,393 S288G probably benign Het
Obscn A G 11: 59,078,302 Y2700H probably damaging Het
Olfr373 T C 8: 72,100,501 V247A probably benign Het
Olfr788 T A 10: 129,473,154 F154Y probably damaging Het
Pde6b A G 5: 108,388,708 D90G probably damaging Het
Pigo A G 4: 43,022,627 F315L possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ret T C 6: 118,155,401 D1026G probably damaging Het
Rptn A T 3: 93,395,789 Q143L probably benign Het
Rubcnl A G 14: 75,035,470 E210G probably benign Het
Serpina1b T A 12: 103,732,453 T46S probably benign Het
Serpinb9e A T 13: 33,251,626 H14L probably benign Het
Slc25a25 A C 2: 32,420,662 V168G probably benign Het
Slc35e1 T C 8: 72,484,882 T261A possibly damaging Het
Spocd1 T C 4: 129,955,404 probably benign Het
Tmem222 A T 4: 133,268,203 Y178N probably damaging Het
Top1mt C T 15: 75,664,044 E470K probably benign Het
Traj42 T C 14: 54,175,833 probably benign Het
Tshr T C 12: 91,538,102 Y13H probably damaging Het
Uvssa A G 5: 33,409,117 probably null Het
Vmn1r28 G A 6: 58,265,648 V159I probably benign Het
Vmn2r73 T A 7: 85,858,005 T700S probably benign Het
Other mutations in Brpf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Brpf3 APN 17 28836700 utr 3 prime probably benign
IGL01397:Brpf3 APN 17 28817632 missense probably benign 0.22
IGL01608:Brpf3 APN 17 28821517 missense probably benign 0.00
IGL02073:Brpf3 APN 17 28807396 missense probably benign
IGL02540:Brpf3 APN 17 28828354 missense probably damaging 1.00
IGL02838:Brpf3 APN 17 28835784 missense probably benign 0.19
IGL02888:Brpf3 APN 17 28828391 missense probably damaging 1.00
IGL02969:Brpf3 APN 17 28821305 missense probably benign 0.05
IGL03036:Brpf3 APN 17 28824048 missense possibly damaging 0.89
IGL03084:Brpf3 APN 17 28835777 missense probably damaging 0.98
R0448:Brpf3 UTSW 17 28806036 missense probably benign 0.10
R0898:Brpf3 UTSW 17 28806990 missense possibly damaging 0.65
R1268:Brpf3 UTSW 17 28836556 missense probably damaging 0.98
R1639:Brpf3 UTSW 17 28824068 critical splice donor site probably null
R1754:Brpf3 UTSW 17 28821323 missense probably benign 0.00
R1867:Brpf3 UTSW 17 28807368 missense probably benign
R1954:Brpf3 UTSW 17 28806559 missense probably benign
R2000:Brpf3 UTSW 17 28821557 missense probably benign 0.20
R2064:Brpf3 UTSW 17 28821364 missense probably benign
R2209:Brpf3 UTSW 17 28828420 missense probably damaging 0.98
R2413:Brpf3 UTSW 17 28805950 start gained probably benign
R3977:Brpf3 UTSW 17 28807042 missense possibly damaging 0.49
R4067:Brpf3 UTSW 17 28821259 missense probably benign
R4291:Brpf3 UTSW 17 28823975 missense probably benign 0.00
R4369:Brpf3 UTSW 17 28836620 missense probably damaging 1.00
R4371:Brpf3 UTSW 17 28836620 missense probably damaging 1.00
R4741:Brpf3 UTSW 17 28817784 missense possibly damaging 0.50
R4773:Brpf3 UTSW 17 28821259 missense probably benign 0.00
R4824:Brpf3 UTSW 17 28806486 missense probably benign
R5360:Brpf3 UTSW 17 28810562 missense probably benign
R5923:Brpf3 UTSW 17 28806636 missense possibly damaging 0.90
R6181:Brpf3 UTSW 17 28810581 missense probably damaging 1.00
R6278:Brpf3 UTSW 17 28821284 missense probably benign 0.00
R6702:Brpf3 UTSW 17 28810659 missense probably benign 0.01
R6920:Brpf3 UTSW 17 28823996 missense probably benign 0.34
R6976:Brpf3 UTSW 17 28835777 missense probably damaging 0.98
R7099:Brpf3 UTSW 17 28806637 missense probably benign 0.06
R7108:Brpf3 UTSW 17 28817125 missense probably benign 0.01
R7193:Brpf3 UTSW 17 28836691 makesense probably null
R7316:Brpf3 UTSW 17 28814686 missense probably damaging 1.00
R7326:Brpf3 UTSW 17 28806293 missense probably benign 0.00
R7403:Brpf3 UTSW 17 28821356 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTAGAGTCCCTGAGGAAAGG -3'
(R):5'- TGAACAACTAGAGCCTTTTGTGTG -3'

Sequencing Primer
(F):5'- AAAGGGTGGAGGGAGTTGTTG -3'
(R):5'- TAGGGTAAAGATGGCCCTCC -3'
Posted On2018-10-18