Incidental Mutation 'R6883:Olfr1124'
ID536878
Institutional Source Beutler Lab
Gene Symbol Olfr1124
Ensembl Gene ENSMUSG00000050772
Gene Nameolfactory receptor 1124
SynonymsMOR264-3, Olfr1125, GA_x6K02T2Q125-48935224-48935664, GA_x6K02T2Q125-48936945-48937901, MOR264-24
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6883 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87430275-87436623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87435279 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 264 (T264K)
Ref Sequence ENSEMBL: ENSMUSP00000150244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062494] [ENSMUST00000215909]
Predicted Effect probably damaging
Transcript: ENSMUST00000062494
AA Change: T264K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062513
Gene: ENSMUSG00000050772
AA Change: T264K

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 4.2e-52 PFAM
Pfam:7tm_1 47 296 2.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215909
AA Change: T264K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.0324 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 92% (45/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,152,835 H1261L possibly damaging Het
Acaa1b A G 9: 119,156,660 S66P possibly damaging Het
Adh7 A T 3: 138,224,064 E167V probably damaging Het
Ano6 T C 15: 95,962,111 S705P probably damaging Het
Arpc1b T C 5: 145,126,929 V329A probably benign Het
Btla C T 16: 45,242,729 H152Y probably benign Het
Cadps T C 14: 12,465,883 E1009G probably damaging Het
Cttnbp2nl A G 3: 105,011,191 probably null Het
Cyp4a12a G T 4: 115,302,024 V164F probably damaging Het
Duox1 G T 2: 122,324,584 probably null Het
Fmo6 A G 1: 162,929,892 I104T probably damaging Het
Fnbp4 T C 2: 90,745,828 probably null Het
Garem1 T C 18: 21,129,712 T682A probably benign Het
Gm49358 A G 10: 86,815,898 E188G probably benign Het
Gm5773 T C 3: 93,773,855 I278T probably benign Het
Ifi27l2a A G 12: 103,443,497 probably benign Het
Inpp5d A C 1: 87,699,690 K308T probably damaging Het
Irf6 A T 1: 193,167,466 Y232F probably damaging Het
Kcnmb4 T C 10: 116,473,343 Q60R probably benign Het
Klri2 T C 6: 129,733,022 D205G probably benign Het
Mcm9 A T 10: 53,616,014 W352R probably damaging Het
Nat8 A G 6: 85,830,668 V161A possibly damaging Het
Nlrp9c A T 7: 26,378,131 M742K probably benign Het
Olfr1436 C A 19: 12,298,570 Q187H probably damaging Het
Olfr71 T C 4: 43,705,723 T282A possibly damaging Het
Pcdha11 A T 18: 37,011,189 D111V probably damaging Het
Pcdhb6 A T 18: 37,335,145 D373V probably damaging Het
Pcolce2 A T 9: 95,678,343 probably null Het
Pik3cb T C 9: 99,101,400 M52V probably benign Het
Pipox T C 11: 77,883,903 E118G probably benign Het
Pou4f2 T C 8: 78,435,678 S99G probably benign Het
Ptpn12 T A 5: 21,055,713 Q12L probably benign Het
Sim2 G T 16: 94,125,536 A540S probably benign Het
Smg1 A T 7: 118,168,180 probably benign Het
Sntb1 A G 15: 55,906,323 V90A probably benign Het
Spns2 T C 11: 72,456,370 probably null Het
Syne1 G T 10: 5,231,704 C4210* probably null Het
Tek T C 4: 94,837,189 I564T possibly damaging Het
Tmem94 T G 11: 115,796,461 C1135W probably damaging Het
Tnxb T A 17: 34,718,519 D3827E probably damaging Het
Ttl A G 2: 129,082,072 D235G possibly damaging Het
Tuba4a A G 1: 75,217,422 S5P probably damaging Het
Uaca T A 9: 60,869,891 V518D probably damaging Het
Unc80 A T 1: 66,646,404 Q2229L probably benign Het
Unkl C T 17: 25,230,333 A78V probably damaging Het
Uroc1 C T 6: 90,338,592 Q152* probably null Het
Vmn2r51 G T 7: 10,100,098 Q338K possibly damaging Het
Vps50 C T 6: 3,498,513 probably benign Het
Other mutations in Olfr1124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Olfr1124 APN 2 87435063 missense probably benign 0.00
IGL01655:Olfr1124 APN 2 87434885 missense probably damaging 1.00
IGL01878:Olfr1124 APN 2 87434970 missense possibly damaging 0.55
IGL02265:Olfr1124 APN 2 87435344 missense probably benign 0.00
IGL02379:Olfr1124 APN 2 87435324 missense probably benign 0.07
IGL02512:Olfr1124 APN 2 87435058 missense possibly damaging 0.59
IGL02578:Olfr1124 APN 2 87435057 missense probably damaging 0.96
R0617:Olfr1124 UTSW 2 87434661 missense probably damaging 1.00
R1376:Olfr1124 UTSW 2 87434559 missense possibly damaging 0.62
R1376:Olfr1124 UTSW 2 87434559 missense possibly damaging 0.62
R4993:Olfr1124 UTSW 2 87435152 missense probably benign 0.00
R5045:Olfr1124 UTSW 2 87435146 missense probably damaging 1.00
R6119:Olfr1124 UTSW 2 87435389 nonsense probably null
R6146:Olfr1124 UTSW 2 87435318 missense possibly damaging 0.78
R6699:Olfr1124 UTSW 2 87434816 missense probably benign
R6966:Olfr1124 UTSW 2 87435279 missense probably damaging 0.98
R7383:Olfr1124 UTSW 2 87435377 missense possibly damaging 0.91
Z1088:Olfr1124 UTSW 2 87435159 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGAGATGATGGTTTTCCTAGG -3'
(R):5'- TTCTGCAAACTTAGACACATACAAAGG -3'

Sequencing Primer
(F):5'- AGATGATGGTTTTCCTAGGTGCTTTC -3'
(R):5'- TCACTCTGTAGACCAAGCTGG -3'
Posted On2018-10-18