Incidental Mutation 'R6883:Uaca'
ID536899
Institutional Source Beutler Lab
Gene Symbol Uaca
Ensembl Gene ENSMUSG00000034485
Gene Nameuveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms2700059D02Rik, nucling
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R6883 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location60794542-60880370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60869891 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 518 (V518D)
Ref Sequence ENSEMBL: ENSMUSP00000151172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050183] [ENSMUST00000214354]
Predicted Effect probably damaging
Transcript: ENSMUST00000050183
AA Change: V520D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062047
Gene: ENSMUSG00000034485
AA Change: V520D

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
ANK 35 68 2.66e3 SMART
ANK 69 98 1.96e-3 SMART
ANK 102 131 1.65e-1 SMART
ANK 135 164 1.38e-3 SMART
ANK 168 197 3.65e-3 SMART
ANK 201 230 6.26e-2 SMART
Blast:ANK 234 263 7e-9 BLAST
coiled coil region 301 381 N/A INTRINSIC
coiled coil region 445 626 N/A INTRINSIC
Pfam:TolA_bind_tri 869 943 4e-11 PFAM
coiled coil region 1009 1382 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214354
AA Change: V518D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 92% (45/49)
MGI Phenotype PHENOTYPE: Homozygous mice display swelling of and inflammatory lesions in the preputial gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,152,835 H1261L possibly damaging Het
Acaa1b A G 9: 119,156,660 S66P possibly damaging Het
Adh7 A T 3: 138,224,064 E167V probably damaging Het
Ano6 T C 15: 95,962,111 S705P probably damaging Het
Arpc1b T C 5: 145,126,929 V329A probably benign Het
Btla C T 16: 45,242,729 H152Y probably benign Het
Cadps T C 14: 12,465,883 E1009G probably damaging Het
Cttnbp2nl A G 3: 105,011,191 probably null Het
Cyp4a12a G T 4: 115,302,024 V164F probably damaging Het
Duox1 G T 2: 122,324,584 probably null Het
Fmo6 A G 1: 162,929,892 I104T probably damaging Het
Fnbp4 T C 2: 90,745,828 probably null Het
Garem1 T C 18: 21,129,712 T682A probably benign Het
Gm49358 A G 10: 86,815,898 E188G probably benign Het
Gm5773 T C 3: 93,773,855 I278T probably benign Het
Ifi27l2a A G 12: 103,443,497 probably benign Het
Inpp5d A C 1: 87,699,690 K308T probably damaging Het
Irf6 A T 1: 193,167,466 Y232F probably damaging Het
Kcnmb4 T C 10: 116,473,343 Q60R probably benign Het
Klri2 T C 6: 129,733,022 D205G probably benign Het
Mcm9 A T 10: 53,616,014 W352R probably damaging Het
Nat8 A G 6: 85,830,668 V161A possibly damaging Het
Nlrp9c A T 7: 26,378,131 M742K probably benign Het
Olfr1124 C A 2: 87,435,279 T264K probably damaging Het
Olfr1436 C A 19: 12,298,570 Q187H probably damaging Het
Olfr71 T C 4: 43,705,723 T282A possibly damaging Het
Pcdha11 A T 18: 37,011,189 D111V probably damaging Het
Pcdhb6 A T 18: 37,335,145 D373V probably damaging Het
Pcolce2 A T 9: 95,678,343 probably null Het
Pik3cb T C 9: 99,101,400 M52V probably benign Het
Pipox T C 11: 77,883,903 E118G probably benign Het
Pou4f2 T C 8: 78,435,678 S99G probably benign Het
Ptpn12 T A 5: 21,055,713 Q12L probably benign Het
Sim2 G T 16: 94,125,536 A540S probably benign Het
Smg1 A T 7: 118,168,180 probably benign Het
Sntb1 A G 15: 55,906,323 V90A probably benign Het
Spns2 T C 11: 72,456,370 probably null Het
Syne1 G T 10: 5,231,704 C4210* probably null Het
Tek T C 4: 94,837,189 I564T possibly damaging Het
Tmem94 T G 11: 115,796,461 C1135W probably damaging Het
Tnxb T A 17: 34,718,519 D3827E probably damaging Het
Ttl A G 2: 129,082,072 D235G possibly damaging Het
Tuba4a A G 1: 75,217,422 S5P probably damaging Het
Unc80 A T 1: 66,646,404 Q2229L probably benign Het
Unkl C T 17: 25,230,333 A78V probably damaging Het
Uroc1 C T 6: 90,338,592 Q152* probably null Het
Vmn2r51 G T 7: 10,100,098 Q338K possibly damaging Het
Vps50 C T 6: 3,498,513 probably benign Het
Other mutations in Uaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Uaca APN 9 60872225 missense probably benign
IGL01751:Uaca APN 9 60869857 missense probably damaging 1.00
IGL02868:Uaca APN 9 60863637 missense probably damaging 1.00
IGL02977:Uaca APN 9 60866380 missense probably benign 0.00
IGL03037:Uaca APN 9 60840865 missense probably damaging 1.00
IGL03060:Uaca APN 9 60869866 missense probably damaging 1.00
IGL03083:Uaca APN 9 60863663 missense probably benign 0.28
IGL03266:Uaca APN 9 60863407 missense probably damaging 1.00
IGL03346:Uaca APN 9 60854318 missense probably damaging 1.00
R0408:Uaca UTSW 9 60871859 missense possibly damaging 0.71
R0567:Uaca UTSW 9 60871381 missense probably benign 0.01
R0598:Uaca UTSW 9 60870921 nonsense probably null
R0603:Uaca UTSW 9 60871097 missense possibly damaging 0.60
R0655:Uaca UTSW 9 60872029 missense probably benign 0.03
R0707:Uaca UTSW 9 60848618 splice site probably benign
R0791:Uaca UTSW 9 60872059 missense possibly damaging 0.50
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1466:Uaca UTSW 9 60854321 missense possibly damaging 0.88
R1520:Uaca UTSW 9 60871381 missense probably benign 0.30
R1673:Uaca UTSW 9 60872156 missense probably damaging 1.00
R1894:Uaca UTSW 9 60870436 missense possibly damaging 0.87
R1997:Uaca UTSW 9 60870341 missense probably damaging 1.00
R2042:Uaca UTSW 9 60869891 missense probably damaging 1.00
R2095:Uaca UTSW 9 60840843 missense probably benign 0.00
R2148:Uaca UTSW 9 60869679 missense probably damaging 1.00
R2384:Uaca UTSW 9 60869917 missense probably damaging 1.00
R3110:Uaca UTSW 9 60871499 missense probably damaging 1.00
R3112:Uaca UTSW 9 60871499 missense probably damaging 1.00
R4001:Uaca UTSW 9 60871084 missense probably benign 0.04
R4155:Uaca UTSW 9 60871753 missense probably benign 0.02
R4156:Uaca UTSW 9 60871753 missense probably benign 0.02
R4157:Uaca UTSW 9 60871753 missense probably benign 0.02
R4410:Uaca UTSW 9 60869891 missense probably damaging 1.00
R4674:Uaca UTSW 9 60854429 missense possibly damaging 0.94
R4871:Uaca UTSW 9 60846001 missense probably damaging 1.00
R5130:Uaca UTSW 9 60880228 missense probably damaging 0.96
R5328:Uaca UTSW 9 60870532 missense probably benign 0.44
R5358:Uaca UTSW 9 60871148 missense probably benign
R5415:Uaca UTSW 9 60870139 missense possibly damaging 0.65
R5437:Uaca UTSW 9 60871451 missense probably benign
R5647:Uaca UTSW 9 60872098 missense probably benign 0.28
R5710:Uaca UTSW 9 60871811 missense probably damaging 1.00
R5920:Uaca UTSW 9 60869603 missense probably benign 0.19
R5931:Uaca UTSW 9 60872012 missense probably damaging 0.97
R5933:Uaca UTSW 9 60840956 missense probably damaging 1.00
R5959:Uaca UTSW 9 60870770 missense probably damaging 1.00
R6193:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6195:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6242:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6243:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6244:Uaca UTSW 9 60870044 missense probably damaging 0.99
R6274:Uaca UTSW 9 60850291 splice site probably null
R6670:Uaca UTSW 9 60872024 missense probably benign 0.09
R7011:Uaca UTSW 9 60870368 missense probably damaging 1.00
R7111:Uaca UTSW 9 60871838 missense probably benign 0.06
R7146:Uaca UTSW 9 60870413 missense probably damaging 0.99
X0067:Uaca UTSW 9 60859149 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ACAGGACCGACTGAAGTTCC -3'
(R):5'- GACTTCACATGTGCCGCATTC -3'

Sequencing Primer
(F):5'- GTTCCAAAACGAACTGGCTC -3'
(R):5'- TTGAACTCTCCCACCAGCATC -3'
Posted On2018-10-18