Incidental Mutation 'R6887:Jmjd1c'
ID537002
Institutional Source Beutler Lab
Gene Symbol Jmjd1c
Ensembl Gene ENSMUSG00000037876
Gene Namejumonji domain containing 1C
SynonymsTRIP8, D630035I23Rik, 5430433L24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R6887 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location67096125-67256326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67189820 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 139 (T139A)
Ref Sequence ENSEMBL: ENSMUSP00000134551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051446] [ENSMUST00000173689] [ENSMUST00000174317] [ENSMUST00000174408]
Predicted Effect probably benign
Transcript: ENSMUST00000051446
AA Change: T139A

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000056227
Gene: ENSMUSG00000037876
AA Change: T139A

DomainStartEndE-ValueType
Blast:JmjC 143 2236 N/A BLAST
JmjC 2264 2488 3.29e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173689
SMART Domains Protein: ENSMUSP00000133700
Gene: ENSMUSG00000037876

DomainStartEndE-ValueType
Blast:JmjC 1 2056 N/A BLAST
JmjC 2084 2308 3.29e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174317
SMART Domains Protein: ENSMUSP00000134246
Gene: ENSMUSG00000037876

DomainStartEndE-ValueType
Blast:JmjC 1 744 N/A BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000174408
AA Change: T139A

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134551
Gene: ENSMUSG00000037876
AA Change: T139A

DomainStartEndE-ValueType
Blast:JmjC 143 2237 N/A BLAST
JmjC 2265 2489 3.29e-53 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptors and contains a jumonji domain. It is a candidate histone demethylase and is thought to be a coactivator for key transcription factors. It plays a role in the DNA-damage response pathway by demethylating the mediator of DNA damage checkpoint 1 (MDC1) protein, and is required for the survival of acute myeloid leukemia. Mutations in this gene are associated with Rett syndrome and intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an age-dependent male infertility phenotype, characterized by early loss of undifferentiated spermatogonia, and a progressive reduction in testis size/weight and male germ cells, partly due to increased male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan G A 7: 79,092,483 V543I probably damaging Het
Adcy5 A G 16: 35,298,590 I1104V possibly damaging Het
Adgrl4 A T 3: 151,542,733 I681F possibly damaging Het
Adgrv1 T A 13: 81,528,701 M2004L probably benign Het
Anapc1 A G 2: 128,659,768 S785P possibly damaging Het
Ap3d1 A T 10: 80,723,698 I242N probably damaging Het
Arhgap5 T C 12: 52,519,144 L966P probably benign Het
Atp8a1 T C 5: 67,738,451 T547A probably benign Het
Cadps A G 14: 12,505,811 F753S probably damaging Het
Cdc20b T C 13: 113,078,653 S252P possibly damaging Het
Cep63 A G 9: 102,625,927 probably benign Het
Chrna5 G T 9: 55,005,133 V302L probably benign Het
Crtc2 A G 3: 90,261,071 T374A probably damaging Het
Dmtf1 T G 5: 9,137,149 D140A probably damaging Het
Exosc8 C T 3: 54,733,699 V39M probably damaging Het
Fam135b A C 15: 71,463,315 S677A probably damaging Het
Hif1an T C 19: 44,563,389 Y93H probably damaging Het
Hrc T C 7: 45,335,664 F80L probably benign Het
Kdr T G 5: 75,968,451 R178S probably benign Het
Lrrc61 A C 6: 48,568,432 N63T probably damaging Het
Mrc1 C T 2: 14,325,237 A1219V possibly damaging Het
Neto1 T C 18: 86,498,635 V359A probably benign Het
Ngly1 T C 14: 16,281,836 I364T probably benign Het
Nisch C T 14: 31,185,344 probably benign Het
Olfr1373 C A 11: 52,145,352 M59I probably benign Het
Prrc2a T C 17: 35,155,675 D1333G probably damaging Het
Raly G T 2: 154,861,910 V134F probably damaging Het
Rbm6 T C 9: 107,852,231 Y406C probably damaging Het
Robo4 G C 9: 37,402,067 E6Q possibly damaging Het
Scnn1g C A 7: 121,760,444 S383R probably benign Het
Sgtb T C 13: 104,111,151 W13R probably benign Het
Slit3 T C 11: 35,544,806 probably null Het
Tbc1d32 G A 10: 56,151,811 Q732* probably null Het
Tek T A 4: 94,804,944 C247S probably damaging Het
Tmf1 A T 6: 97,176,838 D91E probably damaging Het
Usp39 A G 6: 72,333,157 L326P probably damaging Het
Vmn2r7 A T 3: 64,690,827 C770S probably damaging Het
Wdr31 C T 4: 62,457,565 G58R probably benign Het
Zfyve26 A G 12: 79,266,449 I54T probably damaging Het
Other mutations in Jmjd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Jmjd1c APN 10 67226715 missense probably damaging 1.00
IGL01604:Jmjd1c APN 10 67249762 missense probably damaging 1.00
IGL01753:Jmjd1c APN 10 67232015 missense probably damaging 1.00
IGL02081:Jmjd1c APN 10 67219526 missense probably benign 0.02
IGL02128:Jmjd1c APN 10 67243869 missense probably damaging 1.00
IGL02134:Jmjd1c APN 10 67220392 missense possibly damaging 0.87
IGL02215:Jmjd1c APN 10 67220322 missense probably damaging 1.00
IGL02408:Jmjd1c APN 10 67226382 missense probably benign 0.00
IGL02502:Jmjd1c APN 10 67225861 missense probably benign 0.13
IGL02546:Jmjd1c APN 10 67225336 missense possibly damaging 0.94
IGL02943:Jmjd1c APN 10 67219654 missense probably damaging 0.99
IGL03171:Jmjd1c APN 10 67225498 missense possibly damaging 0.89
IGL03261:Jmjd1c APN 10 67232070 missense probably damaging 0.99
accordion UTSW 10 67233414 missense probably damaging 0.99
PIT4378001:Jmjd1c UTSW 10 67229913 missense probably damaging 1.00
R0126:Jmjd1c UTSW 10 67219326 missense probably damaging 0.98
R0133:Jmjd1c UTSW 10 67240808 missense probably benign 0.22
R0201:Jmjd1c UTSW 10 67219109 missense unknown
R0396:Jmjd1c UTSW 10 67219523 missense possibly damaging 0.82
R0401:Jmjd1c UTSW 10 67220382 missense probably damaging 1.00
R0452:Jmjd1c UTSW 10 67255482 missense probably benign 0.28
R0488:Jmjd1c UTSW 10 67240727 missense probably damaging 0.99
R0504:Jmjd1c UTSW 10 67225755 missense probably damaging 1.00
R0555:Jmjd1c UTSW 10 67225789 missense probably benign 0.01
R0673:Jmjd1c UTSW 10 67226809 missense probably damaging 1.00
R0718:Jmjd1c UTSW 10 67218946 splice site probably null
R0755:Jmjd1c UTSW 10 67096599 intron probably benign
R1142:Jmjd1c UTSW 10 67225345 missense probably damaging 1.00
R1196:Jmjd1c UTSW 10 67239236 splice site probably benign
R1413:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R1619:Jmjd1c UTSW 10 67219875 missense probably benign 0.25
R1676:Jmjd1c UTSW 10 67224809 missense probably benign 0.02
R1751:Jmjd1c UTSW 10 67225690 missense probably benign
R1950:Jmjd1c UTSW 10 67239922 missense possibly damaging 0.71
R1968:Jmjd1c UTSW 10 67225440 missense probably damaging 1.00
R2049:Jmjd1c UTSW 10 67157998 nonsense probably null
R2061:Jmjd1c UTSW 10 67218426 missense probably damaging 1.00
R2202:Jmjd1c UTSW 10 67239463 splice site probably null
R2203:Jmjd1c UTSW 10 67239463 splice site probably null
R2256:Jmjd1c UTSW 10 67225294 missense probably damaging 1.00
R2312:Jmjd1c UTSW 10 67238850 missense probably damaging 0.98
R2349:Jmjd1c UTSW 10 67255500 missense probably benign
R2392:Jmjd1c UTSW 10 67229904 missense probably damaging 1.00
R3015:Jmjd1c UTSW 10 67157932 missense probably damaging 1.00
R3110:Jmjd1c UTSW 10 67240084 splice site probably benign
R4043:Jmjd1c UTSW 10 67219466 missense possibly damaging 0.55
R4097:Jmjd1c UTSW 10 67219008 missense probably benign 0.09
R4118:Jmjd1c UTSW 10 67219753 missense probably damaging 0.96
R4193:Jmjd1c UTSW 10 67096681 intron probably benign
R4352:Jmjd1c UTSW 10 67244809 missense probably damaging 1.00
R4577:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R4630:Jmjd1c UTSW 10 67157974 nonsense probably null
R4717:Jmjd1c UTSW 10 67158051 nonsense probably null
R4741:Jmjd1c UTSW 10 67224939 missense possibly damaging 0.56
R4774:Jmjd1c UTSW 10 67224792 missense possibly damaging 0.45
R4836:Jmjd1c UTSW 10 67233446 missense probably benign 0.21
R4914:Jmjd1c UTSW 10 67218971 missense probably damaging 1.00
R4939:Jmjd1c UTSW 10 67246137 missense possibly damaging 0.93
R5211:Jmjd1c UTSW 10 67232016 missense probably damaging 1.00
R5215:Jmjd1c UTSW 10 67240701 missense possibly damaging 0.93
R5514:Jmjd1c UTSW 10 67218149 missense probably damaging 1.00
R5530:Jmjd1c UTSW 10 67249762 missense probably damaging 1.00
R5624:Jmjd1c UTSW 10 67233414 missense probably damaging 0.99
R5640:Jmjd1c UTSW 10 67226078 missense probably benign 0.10
R5654:Jmjd1c UTSW 10 67230006 missense probably benign 0.10
R5742:Jmjd1c UTSW 10 67220333 missense probably benign 0.02
R5764:Jmjd1c UTSW 10 67226512 missense probably damaging 1.00
R6118:Jmjd1c UTSW 10 67240012 missense probably damaging 1.00
R6163:Jmjd1c UTSW 10 67248048 missense possibly damaging 0.46
R6256:Jmjd1c UTSW 10 67220408 missense probably damaging 1.00
R6266:Jmjd1c UTSW 10 67249660 missense probably damaging 0.96
R6358:Jmjd1c UTSW 10 67225939 missense probably benign
R6430:Jmjd1c UTSW 10 67224160 missense possibly damaging 0.87
R6455:Jmjd1c UTSW 10 67226016 missense probably benign 0.10
R6895:Jmjd1c UTSW 10 67217090 missense probably benign 0.00
R7041:Jmjd1c UTSW 10 67220609 missense possibly damaging 0.90
R7095:Jmjd1c UTSW 10 67219632 missense probably benign 0.39
R7113:Jmjd1c UTSW 10 67158001 missense probably damaging 0.98
R7225:Jmjd1c UTSW 10 67226065 missense probably benign 0.00
R7249:Jmjd1c UTSW 10 67189817 missense probably benign 0.01
R7361:Jmjd1c UTSW 10 67218364 missense probably benign 0.10
R7383:Jmjd1c UTSW 10 67189758 missense probably benign 0.14
R7460:Jmjd1c UTSW 10 67217036 missense probably benign 0.24
R7475:Jmjd1c UTSW 10 67225313 missense probably benign 0.22
R7502:Jmjd1c UTSW 10 67232015 missense not run
Z1088:Jmjd1c UTSW 10 67238174 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGTTAGGTTATACCATTATGACGACC -3'
(R):5'- ACAGGAAGCTGTGTTCACTC -3'

Sequencing Primer
(F):5'- CCATTATGACGACCTTATTGAACC -3'
(R):5'- AGGAAGCTGTGTTCACTCCTGTAATC -3'
Posted On2018-10-18