Incidental Mutation 'R6888:Sppl2a'
ID537028
Institutional Source Beutler Lab
Gene Symbol Sppl2a
Ensembl Gene ENSMUSG00000027366
Gene Namesignal peptide peptidase like 2A
SynonymsC130089K23Rik, 2010106G01Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R6888 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location126890391-126933235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126904992 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 472 (V472A)
Ref Sequence ENSEMBL: ENSMUSP00000028844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028844]
Predicted Effect probably damaging
Transcript: ENSMUST00000028844
AA Change: V472A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028844
Gene: ENSMUSG00000027366
AA Change: V472A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:PA 58 153 1.7e-12 PFAM
transmembrane domain 173 195 N/A INTRINSIC
PSN 218 486 3.65e-102 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000119064
Gene: ENSMUSG00000027366
AA Change: V218A

DomainStartEndE-ValueType
PSN 3 233 1.27e-60 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases, which are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions, as well as a member of the signal peptide peptidase-like protease (SPPL) family. This protein is expressed in all major adult human tissues and localizes to late endosomal compartments and lysosomal membranes. A pseudogene of this gene also lies on chromosome 15. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased immunoglobulin prior to and after immunization and decreased splenic B cells, myeloid dendritic cells, T2 B cells and follicular B cells. Mice homozygous for a hypomorphic allele exhibit similar albeit less severe phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,894 Y41H probably damaging Het
Actg1 T C 11: 120,347,315 Y190C probably damaging Het
Adgrv1 A G 13: 81,508,669 I2902T probably damaging Het
AI429214 G A 8: 36,993,833 G45D possibly damaging Het
Ambra1 A G 2: 91,769,027 D164G probably damaging Het
Ap3b1 A T 13: 94,408,791 Q184L probably benign Het
Arhgef17 T C 7: 100,930,820 D307G possibly damaging Het
AY761185 A T 8: 20,944,555 Y52* probably null Het
Bfsp1 A G 2: 143,826,719 S647P probably benign Het
C130073F10Rik A G 4: 101,890,256 V192A probably benign Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Ccdc170 T C 10: 4,546,854 V458A possibly damaging Het
Ccdc187 G A 2: 26,289,734 R238W probably damaging Het
Cdh1 A G 8: 106,658,314 S380G probably benign Het
Cdk5rap3 T C 11: 96,916,192 H4R probably benign Het
Cftr G A 6: 18,313,730 probably null Het
Dnajc16 A G 4: 141,776,992 V219A probably benign Het
Drd3 A T 16: 43,817,139 I266F probably benign Het
Dut A G 2: 125,257,124 D177G probably benign Het
Esr1 A G 10: 4,857,076 I331V probably benign Het
Fam129c G T 8: 71,603,739 R361L probably benign Het
Gm11110 A G 17: 57,102,143 probably benign Het
Grm7 G T 6: 111,358,353 G575V possibly damaging Het
Heatr3 A G 8: 88,170,884 Y531C probably damaging Het
Igfn1 A G 1: 135,982,480 V122A probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Kntc1 T C 5: 123,811,310 Y1915H probably damaging Het
Lamc1 A T 1: 153,262,492 D205E probably damaging Het
Limch1 C T 5: 67,021,926 T713I probably benign Het
Lrp1b A G 2: 41,471,126 I555T probably benign Het
Lrp2 A T 2: 69,524,141 F448I probably damaging Het
March6 T C 15: 31,459,233 K896E probably benign Het
Mpp6 T G 6: 50,180,277 probably null Het
Mroh4 T C 15: 74,613,249 Y469C possibly damaging Het
Nos3 T C 5: 24,383,335 V1060A possibly damaging Het
Nr1h4 A G 10: 89,456,542 I406T probably damaging Het
Odf2l T C 3: 145,148,618 probably null Het
Olfr1162 A G 2: 88,050,264 M120T probably damaging Het
Olfr1387 A T 11: 49,460,260 T194S probably damaging Het
Pbx2 A G 17: 34,594,107 Y119C possibly damaging Het
Pdcd6ip C A 9: 113,671,837 A526S probably benign Het
Prx G A 7: 27,519,634 D1187N possibly damaging Het
Ptpro G A 6: 137,380,200 V230I probably benign Het
Rtn3 C T 19: 7,457,249 M440I probably benign Het
Sar1b T C 11: 51,788,192 I96T probably damaging Het
Sds T C 5: 120,480,900 probably null Het
Secisbp2 A G 13: 51,679,941 T706A probably benign Het
Sorcs3 A T 19: 48,693,824 M433L possibly damaging Het
Tbc1d9 A G 8: 83,271,588 E1258G possibly damaging Het
Tbxas1 C A 6: 38,952,074 probably benign Het
Tg T C 15: 66,696,246 I1333T probably damaging Het
Tmem108 C T 9: 103,499,716 G178D probably damaging Het
Tmem174 A G 13: 98,637,061 L87P probably damaging Het
Tmppe T A 9: 114,404,701 S23T probably damaging Het
Ttn G A 2: 76,761,103 T21074I probably benign Het
Tub A G 7: 109,029,298 M338V probably null Het
Vmn1r160 A T 7: 22,872,106 R295* probably null Het
Vps52 T C 17: 33,963,206 V518A probably benign Het
Wdr59 A G 8: 111,451,043 V909A probably benign Het
Wnk1 T C 6: 119,948,781 T1241A probably benign Het
Zfp882 G A 8: 71,914,286 C319Y probably benign Het
Znfx1 A T 2: 167,038,940 I308N possibly damaging Het
Other mutations in Sppl2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Sppl2a APN 2 126919720 missense probably benign 0.04
IGL01471:Sppl2a APN 2 126917867 nonsense probably null
IGL01572:Sppl2a APN 2 126920312 splice site probably null
IGL01712:Sppl2a APN 2 126904903 splice site probably benign
IGL02203:Sppl2a APN 2 126904941 missense possibly damaging 0.68
IGL02572:Sppl2a APN 2 126926296 missense probably benign 0.07
abra UTSW 2 126923594 missense probably benign 0.00
abra2 UTSW 2 126920313 splice donor site probably null
R0023:Sppl2a UTSW 2 126913293 splice site probably null
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0458:Sppl2a UTSW 2 126904959 missense probably damaging 1.00
R0627:Sppl2a UTSW 2 126920417 unclassified probably benign
R0799:Sppl2a UTSW 2 126920307 splice site probably benign
R1029:Sppl2a UTSW 2 126923594 missense probably benign 0.00
R1245:Sppl2a UTSW 2 126913521 splice site probably benign
R1669:Sppl2a UTSW 2 126917794 splice site probably benign
R2047:Sppl2a UTSW 2 126926852 missense probably damaging 1.00
R2215:Sppl2a UTSW 2 126927834 missense probably benign 0.00
R2428:Sppl2a UTSW 2 126912695 missense possibly damaging 0.93
R3522:Sppl2a UTSW 2 126920322 missense possibly damaging 0.66
R4653:Sppl2a UTSW 2 126920313 splice site probably null
R5398:Sppl2a UTSW 2 126919718 missense probably benign 0.00
R6382:Sppl2a UTSW 2 126917029 intron probably null
R6892:Sppl2a UTSW 2 126913575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGAACTCAGGGCACTCTG -3'
(R):5'- TGTGCCCACAGTCACAAATC -3'

Sequencing Primer
(F):5'- CACTCTGGGGTAATGCTAAGTTCC -3'
(R):5'- GCCCACAGTCACAAATCCACAC -3'
Posted On2018-10-18