Incidental Mutation 'R6888:Kntc1'
ID537038
Institutional Source Beutler Lab
Gene Symbol Kntc1
Ensembl Gene ENSMUSG00000029414
Gene Namekinetochore associated 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.864) question?
Stock #R6888 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location123749716-123821593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123811310 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1915 (Y1915H)
Ref Sequence ENSEMBL: ENSMUSP00000031366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031366]
Predicted Effect probably damaging
Transcript: ENSMUST00000031366
AA Change: Y1915H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031366
Gene: ENSMUSG00000029414
AA Change: Y1915H

DomainStartEndE-ValueType
low complexity region 345 357 N/A INTRINSIC
low complexity region 747 764 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
Pfam:Rod_C 1579 2128 3.2e-256 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197265
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. Experimental evidence indicated that the encoded protein functioned in a similar manner to that of the Drosophila rough deal protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice have a kinked tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,894 Y41H probably damaging Het
Actg1 T C 11: 120,347,315 Y190C probably damaging Het
Adgrv1 A G 13: 81,508,669 I2902T probably damaging Het
AI429214 G A 8: 36,993,833 G45D possibly damaging Het
Ambra1 A G 2: 91,769,027 D164G probably damaging Het
Ap3b1 A T 13: 94,408,791 Q184L probably benign Het
Arhgef17 T C 7: 100,930,820 D307G possibly damaging Het
AY761185 A T 8: 20,944,555 Y52* probably null Het
Bfsp1 A G 2: 143,826,719 S647P probably benign Het
C130073F10Rik A G 4: 101,890,256 V192A probably benign Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Ccdc170 T C 10: 4,546,854 V458A possibly damaging Het
Ccdc187 G A 2: 26,289,734 R238W probably damaging Het
Cdh1 A G 8: 106,658,314 S380G probably benign Het
Cdk5rap3 T C 11: 96,916,192 H4R probably benign Het
Cftr G A 6: 18,313,730 probably null Het
Dnajc16 A G 4: 141,776,992 V219A probably benign Het
Drd3 A T 16: 43,817,139 I266F probably benign Het
Dut A G 2: 125,257,124 D177G probably benign Het
Esr1 A G 10: 4,857,076 I331V probably benign Het
Fam129c G T 8: 71,603,739 R361L probably benign Het
Gm11110 A G 17: 57,102,143 probably benign Het
Grm7 G T 6: 111,358,353 G575V possibly damaging Het
Heatr3 A G 8: 88,170,884 Y531C probably damaging Het
Igfn1 A G 1: 135,982,480 V122A probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Lamc1 A T 1: 153,262,492 D205E probably damaging Het
Limch1 C T 5: 67,021,926 T713I probably benign Het
Lrp1b A G 2: 41,471,126 I555T probably benign Het
Lrp2 A T 2: 69,524,141 F448I probably damaging Het
March6 T C 15: 31,459,233 K896E probably benign Het
Mpp6 T G 6: 50,180,277 probably null Het
Mroh4 T C 15: 74,613,249 Y469C possibly damaging Het
Nos3 T C 5: 24,383,335 V1060A possibly damaging Het
Nr1h4 A G 10: 89,456,542 I406T probably damaging Het
Odf2l T C 3: 145,148,618 probably null Het
Olfr1162 A G 2: 88,050,264 M120T probably damaging Het
Olfr1387 A T 11: 49,460,260 T194S probably damaging Het
Pbx2 A G 17: 34,594,107 Y119C possibly damaging Het
Pdcd6ip C A 9: 113,671,837 A526S probably benign Het
Prx G A 7: 27,519,634 D1187N possibly damaging Het
Ptpro G A 6: 137,380,200 V230I probably benign Het
Rtn3 C T 19: 7,457,249 M440I probably benign Het
Sar1b T C 11: 51,788,192 I96T probably damaging Het
Sds T C 5: 120,480,900 probably null Het
Secisbp2 A G 13: 51,679,941 T706A probably benign Het
Sorcs3 A T 19: 48,693,824 M433L possibly damaging Het
Sppl2a A G 2: 126,904,992 V472A probably damaging Het
Tbc1d9 A G 8: 83,271,588 E1258G possibly damaging Het
Tbxas1 C A 6: 38,952,074 probably benign Het
Tg T C 15: 66,696,246 I1333T probably damaging Het
Tmem108 C T 9: 103,499,716 G178D probably damaging Het
Tmem174 A G 13: 98,637,061 L87P probably damaging Het
Tmppe T A 9: 114,404,701 S23T probably damaging Het
Ttn G A 2: 76,761,103 T21074I probably benign Het
Tub A G 7: 109,029,298 M338V probably null Het
Vmn1r160 A T 7: 22,872,106 R295* probably null Het
Vps52 T C 17: 33,963,206 V518A probably benign Het
Wdr59 A G 8: 111,451,043 V909A probably benign Het
Wnk1 T C 6: 119,948,781 T1241A probably benign Het
Zfp882 G A 8: 71,914,286 C319Y probably benign Het
Znfx1 A T 2: 167,038,940 I308N possibly damaging Het
Other mutations in Kntc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kntc1 APN 5 123790159 missense probably benign 0.05
IGL00514:Kntc1 APN 5 123791527 missense probably benign 0.00
IGL01103:Kntc1 APN 5 123764220 missense probably damaging 0.96
IGL01106:Kntc1 APN 5 123762603 missense probably benign 0.01
IGL01357:Kntc1 APN 5 123757814 missense probably damaging 1.00
IGL01367:Kntc1 APN 5 123758483 missense probably damaging 1.00
IGL01538:Kntc1 APN 5 123781658 missense probably damaging 1.00
IGL01546:Kntc1 APN 5 123765005 missense probably benign 0.02
IGL01595:Kntc1 APN 5 123803695 missense probably benign 0.30
IGL01725:Kntc1 APN 5 123764190 missense probably benign
IGL01916:Kntc1 APN 5 123801913 missense probably damaging 1.00
IGL01936:Kntc1 APN 5 123811376 missense probably damaging 1.00
IGL01942:Kntc1 APN 5 123778267 missense probably damaging 1.00
IGL01973:Kntc1 APN 5 123765958 missense probably damaging 1.00
IGL01982:Kntc1 APN 5 123809096 missense probably benign 0.12
IGL02145:Kntc1 APN 5 123762598 missense possibly damaging 0.80
IGL02510:Kntc1 APN 5 123819062 missense probably benign 0.03
IGL02611:Kntc1 APN 5 123812065 missense probably damaging 1.00
IGL02669:Kntc1 APN 5 123755664 splice site probably benign
IGL02737:Kntc1 APN 5 123819120 missense probably benign 0.17
IGL02793:Kntc1 APN 5 123778277 unclassified probably null
IGL02809:Kntc1 APN 5 123776582 missense probably damaging 1.00
IGL02860:Kntc1 APN 5 123769873 missense possibly damaging 0.49
IGL02875:Kntc1 APN 5 123778277 unclassified probably null
IGL02931:Kntc1 APN 5 123799811 missense probably damaging 1.00
IGL03169:Kntc1 APN 5 123775821 missense possibly damaging 0.80
IGL03267:Kntc1 APN 5 123758480 missense probably damaging 1.00
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0017:Kntc1 UTSW 5 123780981 missense probably damaging 1.00
R0125:Kntc1 UTSW 5 123765057 splice site probably benign
R0324:Kntc1 UTSW 5 123778112 missense probably damaging 1.00
R0580:Kntc1 UTSW 5 123803669 missense probably benign 0.00
R0608:Kntc1 UTSW 5 123786074 missense probably damaging 0.98
R0725:Kntc1 UTSW 5 123769704 missense possibly damaging 0.92
R0733:Kntc1 UTSW 5 123790916 missense probably null
R0781:Kntc1 UTSW 5 123799902 splice site probably benign
R0787:Kntc1 UTSW 5 123796104 missense probably benign
R1250:Kntc1 UTSW 5 123784199 missense possibly damaging 0.71
R1253:Kntc1 UTSW 5 123810862 frame shift probably null
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1481:Kntc1 UTSW 5 123778275 missense probably benign 0.00
R1572:Kntc1 UTSW 5 123772113 missense probably damaging 0.99
R1624:Kntc1 UTSW 5 123758477 missense possibly damaging 0.48
R1749:Kntc1 UTSW 5 123789099 missense probably benign 0.00
R1993:Kntc1 UTSW 5 123759099 critical splice donor site probably null
R1993:Kntc1 UTSW 5 123810811 critical splice acceptor site probably null
R2071:Kntc1 UTSW 5 123794277 splice site probably null
R2237:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2239:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2366:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2367:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2382:Kntc1 UTSW 5 123760348 missense probably damaging 0.99
R2389:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2413:Kntc1 UTSW 5 123764149 missense probably benign 0.01
R2442:Kntc1 UTSW 5 123810859 missense probably damaging 1.00
R2504:Kntc1 UTSW 5 123778347 nonsense probably null
R2943:Kntc1 UTSW 5 123797784 missense possibly damaging 0.68
R3116:Kntc1 UTSW 5 123802058 missense probably damaging 1.00
R4107:Kntc1 UTSW 5 123762598 missense probably damaging 0.99
R4176:Kntc1 UTSW 5 123776617 missense possibly damaging 0.76
R4275:Kntc1 UTSW 5 123767779 missense probably damaging 1.00
R4440:Kntc1 UTSW 5 123794153 missense probably damaging 1.00
R4575:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4576:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4578:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4612:Kntc1 UTSW 5 123812643 missense probably damaging 1.00
R4704:Kntc1 UTSW 5 123811433 missense probably damaging 0.96
R4720:Kntc1 UTSW 5 123765023 missense possibly damaging 0.65
R4784:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4785:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4824:Kntc1 UTSW 5 123790133 nonsense probably null
R4847:Kntc1 UTSW 5 123802274 missense probably benign 0.18
R4849:Kntc1 UTSW 5 123759065 missense probably benign 0.02
R4904:Kntc1 UTSW 5 123778333 missense possibly damaging 0.47
R4922:Kntc1 UTSW 5 123802246 missense probably damaging 0.99
R5080:Kntc1 UTSW 5 123762586 missense possibly damaging 0.68
R5114:Kntc1 UTSW 5 123781055 critical splice donor site probably null
R5171:Kntc1 UTSW 5 123799844 missense probably benign 0.01
R5220:Kntc1 UTSW 5 123812097 missense probably damaging 1.00
R5226:Kntc1 UTSW 5 123794172 missense probably benign 0.09
R5278:Kntc1 UTSW 5 123781014 missense probably damaging 1.00
R5329:Kntc1 UTSW 5 123764191 missense probably benign 0.02
R5496:Kntc1 UTSW 5 123784182 missense probably benign 0.00
R5503:Kntc1 UTSW 5 123819876 missense possibly damaging 0.81
R5633:Kntc1 UTSW 5 123819057 missense probably damaging 0.99
R5638:Kntc1 UTSW 5 123818475 missense possibly damaging 0.65
R5697:Kntc1 UTSW 5 123765007 missense probably benign 0.00
R5757:Kntc1 UTSW 5 123807309 critical splice donor site probably null
R5773:Kntc1 UTSW 5 123794157 missense probably damaging 1.00
R5940:Kntc1 UTSW 5 123786195 missense probably benign 0.05
R6019:Kntc1 UTSW 5 123762516 missense probably benign 0.03
R6230:Kntc1 UTSW 5 123789009 splice site probably null
R6437:Kntc1 UTSW 5 123769691 missense probably damaging 0.98
R6907:Kntc1 UTSW 5 123801825 missense probably damaging 1.00
R7123:Kntc1 UTSW 5 123781726 missense not run
X0027:Kntc1 UTSW 5 123810929 missense probably benign 0.00
X0065:Kntc1 UTSW 5 123778037 nonsense probably null
X0067:Kntc1 UTSW 5 123778074 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCAACATTTGGAAGTTGACTG -3'
(R):5'- AAAGATCTTTGGGCATCTGGG -3'

Sequencing Primer
(F):5'- GCAACATTTGGAAGTTGACTGTTTCC -3'
(R):5'- TGGGTGACTGGGTGACACAC -3'
Posted On2018-10-18