Incidental Mutation 'R6888:Cacna1g'
ID537065
Institutional Source Beutler Lab
Gene Symbol Cacna1g
Ensembl Gene ENSMUSG00000020866
Gene Namecalcium channel, voltage-dependent, T type, alpha 1G subunit
Synonymsa1G, Cav3.1d
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.719) question?
Stock #R6888 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location94408391-94474198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94459207 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 604 (D604V)
Ref Sequence ENSEMBL: ENSMUSP00000103418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021234] [ENSMUST00000100561] [ENSMUST00000103166] [ENSMUST00000107785] [ENSMUST00000107786] [ENSMUST00000107788] [ENSMUST00000107789] [ENSMUST00000107790] [ENSMUST00000107791] [ENSMUST00000107792] [ENSMUST00000107793]
Predicted Effect probably benign
Transcript: ENSMUST00000021234
AA Change: D604V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021234
Gene: ENSMUSG00000020866
AA Change: D604V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 9.2e-66 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 7.9e-46 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 3e-55 PFAM
coiled coil region 1519 1559 N/A INTRINSIC
low complexity region 1562 1573 N/A INTRINSIC
Pfam:Ion_trans 1630 1835 3e-49 PFAM
Pfam:PKD_channel 1688 1842 7.8e-11 PFAM
low complexity region 2180 2211 N/A INTRINSIC
low complexity region 2230 2246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100561
AA Change: D604V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000098127
Gene: ENSMUSG00000020866
AA Change: D604V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6.1e-55 PFAM
coiled coil region 1542 1582 N/A INTRINSIC
low complexity region 1585 1596 N/A INTRINSIC
Pfam:Ion_trans 1653 1858 6.2e-49 PFAM
Pfam:PKD_channel 1711 1865 1.4e-10 PFAM
low complexity region 2203 2234 N/A INTRINSIC
low complexity region 2253 2269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103166
AA Change: D604V

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099455
Gene: ENSMUSG00000020866
AA Change: D604V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6.1e-55 PFAM
SCOP:d1g2qa_ 1545 1589 6e-3 SMART
Pfam:Ion_trans 1646 1851 6.2e-49 PFAM
Pfam:PKD_channel 1704 1858 1.4e-10 PFAM
low complexity region 2196 2227 N/A INTRINSIC
low complexity region 2246 2262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107785
AA Change: D604V

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103414
Gene: ENSMUSG00000020866
AA Change: D604V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.8e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.5e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 5.7e-55 PFAM
coiled coil region 1519 1558 N/A INTRINSIC
Pfam:Ion_trans 1612 1817 5.8e-49 PFAM
Pfam:PKD_channel 1670 1824 1.4e-10 PFAM
low complexity region 2027 2042 N/A INTRINSIC
low complexity region 2084 2115 N/A INTRINSIC
low complexity region 2134 2150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107786
AA Change: D587V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103415
Gene: ENSMUSG00000020866
AA Change: D587V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 383 4e-60 PFAM
low complexity region 466 490 N/A INTRINSIC
low complexity region 518 530 N/A INTRINSIC
Pfam:Ion_trans 760 946 1.6e-45 PFAM
low complexity region 1023 1034 N/A INTRINSIC
low complexity region 1046 1073 N/A INTRINSIC
low complexity region 1094 1110 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
Pfam:Ion_trans 1273 1497 5.9e-55 PFAM
SCOP:d1g2qa_ 1505 1549 6e-3 SMART
Pfam:Ion_trans 1606 1811 6e-49 PFAM
Pfam:PKD_channel 1664 1818 1.4e-10 PFAM
low complexity region 2156 2187 N/A INTRINSIC
low complexity region 2206 2222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107788
AA Change: D604V

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103417
Gene: ENSMUSG00000020866
AA Change: D604V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6e-55 PFAM
coiled coil region 1542 1574 N/A INTRINSIC
Pfam:Ion_trans 1628 1833 6.1e-49 PFAM
Pfam:PKD_channel 1686 1840 1.4e-10 PFAM
low complexity region 2178 2209 N/A INTRINSIC
low complexity region 2228 2244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107789
AA Change: D604V

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103418
Gene: ENSMUSG00000020866
AA Change: D604V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 80 406 1.6e-76 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 742 972 3.4e-56 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1276 1549 1.5e-61 PFAM
low complexity region 1578 1589 N/A INTRINSIC
Pfam:Ion_trans 1611 1863 2.1e-56 PFAM
Pfam:PKD_channel 1703 1858 3.4e-9 PFAM
low complexity region 2289 2320 N/A INTRINSIC
low complexity region 2339 2355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107790
AA Change: D604V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103419
Gene: ENSMUSG00000020866
AA Change: D604V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 6e-55 PFAM
SCOP:d1g2qa_ 1522 1566 6e-3 SMART
Pfam:Ion_trans 1623 1828 6.1e-49 PFAM
Pfam:PKD_channel 1681 1835 1.4e-10 PFAM
low complexity region 2173 2204 N/A INTRINSIC
low complexity region 2223 2239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107791
AA Change: D604V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000103420
Gene: ENSMUSG00000020866
AA Change: D604V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.8e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 6e-55 PFAM
coiled coil region 1519 1558 N/A INTRINSIC
Pfam:Ion_trans 1612 1817 6e-49 PFAM
Pfam:PKD_channel 1670 1824 1.4e-10 PFAM
low complexity region 2162 2193 N/A INTRINSIC
low complexity region 2212 2228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107792
AA Change: D604V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103421
Gene: ENSMUSG00000020866
AA Change: D604V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.8e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1040 1051 N/A INTRINSIC
low complexity region 1063 1090 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Pfam:Ion_trans 1290 1514 5.9e-55 PFAM
coiled coil region 1519 1551 N/A INTRINSIC
Pfam:Ion_trans 1605 1810 6e-49 PFAM
Pfam:PKD_channel 1663 1817 1.4e-10 PFAM
low complexity region 2155 2186 N/A INTRINSIC
low complexity region 2205 2221 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107793
AA Change: D604V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103422
Gene: ENSMUSG00000020866
AA Change: D604V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Ion_trans 119 394 1.9e-65 PFAM
low complexity region 483 507 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
Pfam:Ion_trans 777 963 1.6e-45 PFAM
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1086 1113 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1216 1227 N/A INTRINSIC
Pfam:Ion_trans 1313 1537 6e-55 PFAM
coiled coil region 1542 1581 N/A INTRINSIC
Pfam:Ion_trans 1635 1840 6.1e-49 PFAM
Pfam:PKD_channel 1693 1847 1.4e-10 PFAM
low complexity region 2185 2216 N/A INTRINSIC
low complexity region 2235 2251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152811
Meta Mutation Damage Score 0.1284 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, gene expression, cell motility, cell division, and cell death. This gene encodes a T-type, low-voltage activated calcium channel. The T-type channels generate currents that are both transient, owing to fast inactivation, and tiny, owing to small conductance. T-type channels are thought to be involved in pacemaker activity, low-threshold calcium spikes, neuronal oscillations and resonance, and rebound burst firing. Many alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygote null mice display disrupted sleeping patterns, altered amounts of activity, abnormal action potentials in the brain, prolonged electrical conductance in the heart, and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,894 Y41H probably damaging Het
Actg1 T C 11: 120,347,315 Y190C probably damaging Het
Adgrv1 A G 13: 81,508,669 I2902T probably damaging Het
AI429214 G A 8: 36,993,833 G45D possibly damaging Het
Ambra1 A G 2: 91,769,027 D164G probably damaging Het
Ap3b1 A T 13: 94,408,791 Q184L probably benign Het
Arhgef17 T C 7: 100,930,820 D307G possibly damaging Het
AY761185 A T 8: 20,944,555 Y52* probably null Het
Bfsp1 A G 2: 143,826,719 S647P probably benign Het
C130073F10Rik A G 4: 101,890,256 V192A probably benign Het
Ccdc170 T C 10: 4,546,854 V458A possibly damaging Het
Ccdc187 G A 2: 26,289,734 R238W probably damaging Het
Cdh1 A G 8: 106,658,314 S380G probably benign Het
Cdk5rap3 T C 11: 96,916,192 H4R probably benign Het
Cftr G A 6: 18,313,730 probably null Het
Dnajc16 A G 4: 141,776,992 V219A probably benign Het
Drd3 A T 16: 43,817,139 I266F probably benign Het
Dut A G 2: 125,257,124 D177G probably benign Het
Esr1 A G 10: 4,857,076 I331V probably benign Het
Fam129c G T 8: 71,603,739 R361L probably benign Het
Gm11110 A G 17: 57,102,143 probably benign Het
Grm7 G T 6: 111,358,353 G575V possibly damaging Het
Heatr3 A G 8: 88,170,884 Y531C probably damaging Het
Igfn1 A G 1: 135,982,480 V122A probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Kntc1 T C 5: 123,811,310 Y1915H probably damaging Het
Lamc1 A T 1: 153,262,492 D205E probably damaging Het
Limch1 C T 5: 67,021,926 T713I probably benign Het
Lrp1b A G 2: 41,471,126 I555T probably benign Het
Lrp2 A T 2: 69,524,141 F448I probably damaging Het
March6 T C 15: 31,459,233 K896E probably benign Het
Mpp6 T G 6: 50,180,277 probably null Het
Mroh4 T C 15: 74,613,249 Y469C possibly damaging Het
Nos3 T C 5: 24,383,335 V1060A possibly damaging Het
Nr1h4 A G 10: 89,456,542 I406T probably damaging Het
Odf2l T C 3: 145,148,618 probably null Het
Olfr1162 A G 2: 88,050,264 M120T probably damaging Het
Olfr1387 A T 11: 49,460,260 T194S probably damaging Het
Pbx2 A G 17: 34,594,107 Y119C possibly damaging Het
Pdcd6ip C A 9: 113,671,837 A526S probably benign Het
Prx G A 7: 27,519,634 D1187N possibly damaging Het
Ptpro G A 6: 137,380,200 V230I probably benign Het
Rtn3 C T 19: 7,457,249 M440I probably benign Het
Sar1b T C 11: 51,788,192 I96T probably damaging Het
Sds T C 5: 120,480,900 probably null Het
Secisbp2 A G 13: 51,679,941 T706A probably benign Het
Sorcs3 A T 19: 48,693,824 M433L possibly damaging Het
Sppl2a A G 2: 126,904,992 V472A probably damaging Het
Tbc1d9 A G 8: 83,271,588 E1258G possibly damaging Het
Tbxas1 C A 6: 38,952,074 probably benign Het
Tg T C 15: 66,696,246 I1333T probably damaging Het
Tmem108 C T 9: 103,499,716 G178D probably damaging Het
Tmem174 A G 13: 98,637,061 L87P probably damaging Het
Tmppe T A 9: 114,404,701 S23T probably damaging Het
Ttn G A 2: 76,761,103 T21074I probably benign Het
Tub A G 7: 109,029,298 M338V probably null Het
Vmn1r160 A T 7: 22,872,106 R295* probably null Het
Vps52 T C 17: 33,963,206 V518A probably benign Het
Wdr59 A G 8: 111,451,043 V909A probably benign Het
Wnk1 T C 6: 119,948,781 T1241A probably benign Het
Zfp882 G A 8: 71,914,286 C319Y probably benign Het
Znfx1 A T 2: 167,038,940 I308N possibly damaging Het
Other mutations in Cacna1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Cacna1g APN 11 94433912 missense probably benign 0.16
IGL01382:Cacna1g APN 11 94465858 missense probably damaging 1.00
IGL01694:Cacna1g APN 11 94429112 missense probably damaging 1.00
IGL01866:Cacna1g APN 11 94457111 missense probably damaging 0.99
IGL02341:Cacna1g APN 11 94462152 missense probably damaging 1.00
IGL02506:Cacna1g APN 11 94429129 missense probably damaging 0.99
IGL02706:Cacna1g APN 11 94456992 missense probably damaging 1.00
IGL02879:Cacna1g APN 11 94409605 missense probably benign 0.12
IGL03366:Cacna1g APN 11 94457151 missense probably damaging 1.00
ANU23:Cacna1g UTSW 11 94466228 critical splice acceptor site probably benign
IGL03134:Cacna1g UTSW 11 94459825 missense probably damaging 1.00
R0092:Cacna1g UTSW 11 94457264 missense probably damaging 1.00
R0123:Cacna1g UTSW 11 94409476 missense probably damaging 1.00
R0178:Cacna1g UTSW 11 94463483 missense probably damaging 1.00
R0375:Cacna1g UTSW 11 94411054 missense possibly damaging 0.79
R0389:Cacna1g UTSW 11 94459697 missense probably damaging 1.00
R0433:Cacna1g UTSW 11 94459207 missense probably benign 0.16
R0458:Cacna1g UTSW 11 94409440 missense probably damaging 0.96
R0498:Cacna1g UTSW 11 94459859 missense probably damaging 1.00
R0629:Cacna1g UTSW 11 94409543 missense possibly damaging 0.93
R0800:Cacna1g UTSW 11 94426439 missense probably damaging 1.00
R1341:Cacna1g UTSW 11 94433756 missense probably damaging 0.99
R1457:Cacna1g UTSW 11 94459555 missense possibly damaging 0.76
R1523:Cacna1g UTSW 11 94442729 critical splice donor site probably null
R1532:Cacna1g UTSW 11 94443331 missense probably damaging 1.00
R1540:Cacna1g UTSW 11 94457039 missense probably damaging 1.00
R1652:Cacna1g UTSW 11 94427404 missense probably damaging 1.00
R1688:Cacna1g UTSW 11 94425953 missense possibly damaging 0.70
R1750:Cacna1g UTSW 11 94443292 missense probably damaging 1.00
R1751:Cacna1g UTSW 11 94459802 missense probably benign 0.35
R1767:Cacna1g UTSW 11 94459802 missense probably benign 0.35
R1847:Cacna1g UTSW 11 94466181 missense probably damaging 1.00
R1924:Cacna1g UTSW 11 94444054 missense possibly damaging 0.93
R1973:Cacna1g UTSW 11 94459777 missense possibly damaging 0.86
R2050:Cacna1g UTSW 11 94409474 missense probably damaging 1.00
R2261:Cacna1g UTSW 11 94457135 missense probably benign 0.42
R2273:Cacna1g UTSW 11 94415936 missense probably damaging 0.98
R2274:Cacna1g UTSW 11 94415936 missense probably damaging 0.98
R2275:Cacna1g UTSW 11 94415936 missense probably damaging 0.98
R2376:Cacna1g UTSW 11 94465908 missense probably damaging 0.99
R3686:Cacna1g UTSW 11 94459090 splice site probably null
R3809:Cacna1g UTSW 11 94416096 missense probably damaging 1.00
R3875:Cacna1g UTSW 11 94437923 missense probably damaging 0.98
R4133:Cacna1g UTSW 11 94432544 missense probably damaging 1.00
R4642:Cacna1g UTSW 11 94418094 missense probably damaging 1.00
R4732:Cacna1g UTSW 11 94443215 missense probably damaging 1.00
R4733:Cacna1g UTSW 11 94443215 missense probably damaging 1.00
R4773:Cacna1g UTSW 11 94411472 missense possibly damaging 0.78
R4798:Cacna1g UTSW 11 94433847 missense probably damaging 1.00
R4839:Cacna1g UTSW 11 94459607 missense probably benign 0.16
R4900:Cacna1g UTSW 11 94459351 missense possibly damaging 0.78
R4927:Cacna1g UTSW 11 94429147 missense probably damaging 1.00
R4930:Cacna1g UTSW 11 94444073 missense probably damaging 1.00
R5050:Cacna1g UTSW 11 94459715 missense probably damaging 1.00
R5117:Cacna1g UTSW 11 94432503 missense probably damaging 1.00
R5186:Cacna1g UTSW 11 94442848 missense probably damaging 1.00
R5364:Cacna1g UTSW 11 94416858 missense probably benign 0.29
R5512:Cacna1g UTSW 11 94444142 missense probably damaging 1.00
R5564:Cacna1g UTSW 11 94430486 missense probably damaging 1.00
R5603:Cacna1g UTSW 11 94439752 missense possibly damaging 0.76
R5682:Cacna1g UTSW 11 94459114 missense probably damaging 1.00
R5818:Cacna1g UTSW 11 94418120 missense probably damaging 1.00
R5828:Cacna1g UTSW 11 94457154 missense probably damaging 1.00
R5882:Cacna1g UTSW 11 94459819 missense probably damaging 1.00
R5884:Cacna1g UTSW 11 94437867 missense probably damaging 1.00
R6075:Cacna1g UTSW 11 94416665 missense probably damaging 1.00
R6112:Cacna1g UTSW 11 94409246 missense probably damaging 0.98
R6122:Cacna1g UTSW 11 94430171 missense probably benign 0.11
R6145:Cacna1g UTSW 11 94462261 missense probably damaging 1.00
R6362:Cacna1g UTSW 11 94439707 critical splice donor site probably null
R6415:Cacna1g UTSW 11 94463417 missense probably damaging 1.00
R6468:Cacna1g UTSW 11 94439722 missense probably damaging 1.00
R6648:Cacna1g UTSW 11 94432569 missense probably damaging 1.00
R6746:Cacna1g UTSW 11 94409427 nonsense probably null
R6764:Cacna1g UTSW 11 94413188 missense possibly damaging 0.95
R6782:Cacna1g UTSW 11 94459550 missense probably damaging 1.00
R7148:Cacna1g UTSW 11 94465930 missense probably benign 0.32
R7181:Cacna1g UTSW 11 94415865 missense probably benign 0.21
R7183:Cacna1g UTSW 11 94439737 missense probably benign 0.04
R7193:Cacna1g UTSW 11 94409231 missense possibly damaging 0.60
R7237:Cacna1g UTSW 11 94437879 missense probably benign 0.21
R7254:Cacna1g UTSW 11 94432567 nonsense probably null
R7312:Cacna1g UTSW 11 94432557 missense probably damaging 1.00
X0001:Cacna1g UTSW 11 94409645 missense possibly damaging 0.90
X0019:Cacna1g UTSW 11 94459253 missense probably damaging 0.97
X0065:Cacna1g UTSW 11 94462425 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAACCTGGAATCTGCACC -3'
(R):5'- AATGGGACGCTCAGAGTTC -3'

Sequencing Primer
(F):5'- TGGAATCTGCACCCTGGG -3'
(R):5'- ACAGGGATGCCAATGGGTCC -3'
Posted On2018-10-18