Incidental Mutation 'R6888:Vps52'
ID537076
Institutional Source Beutler Lab
Gene Symbol Vps52
Ensembl Gene ENSMUSG00000024319
Gene NameVPS52 GARP complex subunit
Synonymstclw5, ARE1, Sacm2l, D430041K17Rik, tcl-w5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6888 (G1)
Quality Score220.009
Status Not validated
Chromosome17
Chromosomal Location33955812-33966984 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33963206 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 518 (V518A)
Ref Sequence ENSEMBL: ENSMUSP00000133926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025178] [ENSMUST00000173196]
Predicted Effect probably benign
Transcript: ENSMUST00000025178
AA Change: V586A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319
AA Change: V586A

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
low complexity region 24 45 N/A INTRINSIC
Pfam:Sec3_C 79 244 4.6e-13 PFAM
Pfam:Vps52 94 601 5.1e-233 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173196
AA Change: V518A

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000133926
Gene: ENSMUSG00000024319
AA Change: V518A

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
Pfam:Vps52 88 120 2.7e-6 PFAM
Pfam:Vps52 116 527 3e-181 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the yeast suppressor of actin mutations 2 gene. The yeast protein forms a subunit of the tetrameric Golgi-associated retrograde protein complex that is involved in vesicle trafficking from from both early and late endosomes, back to the trans-Golgi network. This gene is located on chromosome 6 in a head-to-head orientation with the gene encoding ribosomal protein S18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,894 Y41H probably damaging Het
Actg1 T C 11: 120,347,315 Y190C probably damaging Het
Adgrv1 A G 13: 81,508,669 I2902T probably damaging Het
AI429214 G A 8: 36,993,833 G45D possibly damaging Het
Ambra1 A G 2: 91,769,027 D164G probably damaging Het
Ap3b1 A T 13: 94,408,791 Q184L probably benign Het
Arhgef17 T C 7: 100,930,820 D307G possibly damaging Het
AY761185 A T 8: 20,944,555 Y52* probably null Het
Bfsp1 A G 2: 143,826,719 S647P probably benign Het
C130073F10Rik A G 4: 101,890,256 V192A probably benign Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Ccdc170 T C 10: 4,546,854 V458A possibly damaging Het
Ccdc187 G A 2: 26,289,734 R238W probably damaging Het
Cdh1 A G 8: 106,658,314 S380G probably benign Het
Cdk5rap3 T C 11: 96,916,192 H4R probably benign Het
Cftr G A 6: 18,313,730 probably null Het
Dnajc16 A G 4: 141,776,992 V219A probably benign Het
Drd3 A T 16: 43,817,139 I266F probably benign Het
Dut A G 2: 125,257,124 D177G probably benign Het
Esr1 A G 10: 4,857,076 I331V probably benign Het
Fam129c G T 8: 71,603,739 R361L probably benign Het
Gm11110 A G 17: 57,102,143 probably benign Het
Grm7 G T 6: 111,358,353 G575V possibly damaging Het
Heatr3 A G 8: 88,170,884 Y531C probably damaging Het
Igfn1 A G 1: 135,982,480 V122A probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Kntc1 T C 5: 123,811,310 Y1915H probably damaging Het
Lamc1 A T 1: 153,262,492 D205E probably damaging Het
Limch1 C T 5: 67,021,926 T713I probably benign Het
Lrp1b A G 2: 41,471,126 I555T probably benign Het
Lrp2 A T 2: 69,524,141 F448I probably damaging Het
March6 T C 15: 31,459,233 K896E probably benign Het
Mpp6 T G 6: 50,180,277 probably null Het
Mroh4 T C 15: 74,613,249 Y469C possibly damaging Het
Nos3 T C 5: 24,383,335 V1060A possibly damaging Het
Nr1h4 A G 10: 89,456,542 I406T probably damaging Het
Odf2l T C 3: 145,148,618 probably null Het
Olfr1162 A G 2: 88,050,264 M120T probably damaging Het
Olfr1387 A T 11: 49,460,260 T194S probably damaging Het
Pbx2 A G 17: 34,594,107 Y119C possibly damaging Het
Pdcd6ip C A 9: 113,671,837 A526S probably benign Het
Prx G A 7: 27,519,634 D1187N possibly damaging Het
Ptpro G A 6: 137,380,200 V230I probably benign Het
Rtn3 C T 19: 7,457,249 M440I probably benign Het
Sar1b T C 11: 51,788,192 I96T probably damaging Het
Sds T C 5: 120,480,900 probably null Het
Secisbp2 A G 13: 51,679,941 T706A probably benign Het
Sorcs3 A T 19: 48,693,824 M433L possibly damaging Het
Sppl2a A G 2: 126,904,992 V472A probably damaging Het
Tbc1d9 A G 8: 83,271,588 E1258G possibly damaging Het
Tbxas1 C A 6: 38,952,074 probably benign Het
Tg T C 15: 66,696,246 I1333T probably damaging Het
Tmem108 C T 9: 103,499,716 G178D probably damaging Het
Tmem174 A G 13: 98,637,061 L87P probably damaging Het
Tmppe T A 9: 114,404,701 S23T probably damaging Het
Ttn G A 2: 76,761,103 T21074I probably benign Het
Tub A G 7: 109,029,298 M338V probably null Het
Vmn1r160 A T 7: 22,872,106 R295* probably null Het
Wdr59 A G 8: 111,451,043 V909A probably benign Het
Wnk1 T C 6: 119,948,781 T1241A probably benign Het
Zfp882 G A 8: 71,914,286 C319Y probably benign Het
Znfx1 A T 2: 167,038,940 I308N possibly damaging Het
Other mutations in Vps52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Vps52 APN 17 33956958 missense possibly damaging 0.96
IGL01098:Vps52 APN 17 33962730 missense possibly damaging 0.90
IGL01705:Vps52 APN 17 33966068 missense probably damaging 1.00
IGL01722:Vps52 APN 17 33961615 nonsense probably null
IGL02992:Vps52 APN 17 33958350 missense probably damaging 0.97
IGL03279:Vps52 APN 17 33957874 missense probably damaging 0.96
R0363:Vps52 UTSW 17 33962117 missense probably benign 0.26
R0762:Vps52 UTSW 17 33960011 missense probably damaging 1.00
R1065:Vps52 UTSW 17 33961239 missense probably benign 0.02
R1506:Vps52 UTSW 17 33957894 missense probably damaging 1.00
R3760:Vps52 UTSW 17 33960188 missense possibly damaging 0.64
R4714:Vps52 UTSW 17 33961179 missense probably benign 0.25
R5381:Vps52 UTSW 17 33958301 missense possibly damaging 0.77
R5590:Vps52 UTSW 17 33961221 missense probably benign 0.01
R5928:Vps52 UTSW 17 33961126 missense possibly damaging 0.85
R6003:Vps52 UTSW 17 33956094 start codon destroyed probably null 0.01
R6302:Vps52 UTSW 17 33963215 missense probably damaging 1.00
R6574:Vps52 UTSW 17 33962478 missense probably null 0.34
R6695:Vps52 UTSW 17 33963199 nonsense probably null
R7022:Vps52 UTSW 17 33959319 missense probably benign 0.04
R7136:Vps52 UTSW 17 33965288 missense not run
Predicted Primers PCR Primer
(F):5'- ATGGTAATGCTGCTCCTCCC -3'
(R):5'- CAGGGCTATAGTACATGCACAC -3'

Sequencing Primer
(F):5'- CACGGGGGTCCCTACAG -3'
(R):5'- TGTAGCTATAGTACACACACATGC -3'
Posted On2018-10-18