Incidental Mutation 'R6890:Nsun6'
ID537143
Institutional Source Beutler Lab
Gene Symbol Nsun6
Ensembl Gene ENSMUSG00000026707
Gene NameNOL1/NOP2/Sun domain family member 6
Synonyms4933414E04Rik, 4933403D21Rik, NOPD1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location14995131-15055069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15048977 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 7 (I7T)
Ref Sequence ENSEMBL: ENSMUSP00000110361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017562] [ENSMUST00000028034] [ENSMUST00000076435] [ENSMUST00000114713] [ENSMUST00000114715] [ENSMUST00000195749]
Predicted Effect probably benign
Transcript: ENSMUST00000017562
SMART Domains Protein: ENSMUSP00000017562
Gene: ENSMUSG00000017418

DomainStartEndE-ValueType
ARF 4 171 4.8e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000028034
AA Change: I7T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028034
Gene: ENSMUSG00000026707
AA Change: I7T

DomainStartEndE-ValueType
PUA 112 203 1.96e-4 SMART
Pfam:FtsJ 216 397 1.4e-8 PFAM
Pfam:Methyltransf_31 232 423 1.3e-9 PFAM
Pfam:Methyltransf_18 234 373 1.4e-8 PFAM
Pfam:Methyltransf_26 235 374 2.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000076435
AA Change: I7T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075766
Gene: ENSMUSG00000026707
AA Change: I7T

DomainStartEndE-ValueType
PUA 112 203 1.96e-4 SMART
Pfam:FtsJ 224 392 4.7e-9 PFAM
Pfam:Nol1_Nop2_Fmu 227 464 4.7e-48 PFAM
Pfam:Methyltransf_31 232 423 8.8e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114713
AA Change: I7T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000114715
SMART Domains Protein: ENSMUSP00000110363
Gene: ENSMUSG00000026707

DomainStartEndE-ValueType
PUA 61 152 1.96e-4 SMART
Pfam:FtsJ 165 346 4.5e-9 PFAM
Pfam:Methyltransf_31 181 372 2.3e-10 PFAM
Pfam:Methyltransf_18 183 322 2.8e-9 PFAM
Pfam:Methyltransf_26 184 323 5.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195749
AA Change: I7T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141924
Gene: ENSMUSG00000026707
AA Change: I7T

DomainStartEndE-ValueType
PUA 112 203 1.96e-4 SMART
Pfam:FtsJ 216 397 1.4e-8 PFAM
Pfam:Methyltransf_31 232 423 1.3e-9 PFAM
Pfam:Methyltransf_18 234 373 1.4e-8 PFAM
Pfam:Methyltransf_26 235 374 2.9e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Nsun6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Nsun6 APN 2 15048978 missense possibly damaging 0.69
IGL02347:Nsun6 APN 2 15030020 splice site probably benign
IGL03352:Nsun6 APN 2 14996346 nonsense probably null
R0371:Nsun6 UTSW 2 15030087 missense probably damaging 1.00
R0639:Nsun6 UTSW 2 14996336 missense probably benign
R0737:Nsun6 UTSW 2 14996474 missense probably damaging 1.00
R1076:Nsun6 UTSW 2 15009472 missense probably benign 0.01
R1676:Nsun6 UTSW 2 15047213 nonsense probably null
R1842:Nsun6 UTSW 2 15009477 missense probably damaging 0.98
R1989:Nsun6 UTSW 2 15038184 missense probably benign
R2091:Nsun6 UTSW 2 15039731 critical splice donor site probably null
R2972:Nsun6 UTSW 2 15038072 critical splice donor site probably null
R3276:Nsun6 UTSW 2 15009404 splice site probably benign
R4386:Nsun6 UTSW 2 14996522 missense probably benign 0.05
R4761:Nsun6 UTSW 2 15030061 missense possibly damaging 0.88
R4782:Nsun6 UTSW 2 15036326 missense possibly damaging 0.88
R6701:Nsun6 UTSW 2 15036302 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCAGTAAGCATCAATGGTGAC -3'
(R):5'- TATTTGGCGCAGTGTCGCAG -3'

Sequencing Primer
(F):5'- TCTGCTGAAGTTGTATCAG -3'
(R):5'- CAGTTCGGAGCTGTCTCAC -3'
Posted On2018-10-18