Incidental Mutation 'R6890:Arhgef10l'
ID537149
Institutional Source Beutler Lab
Gene Symbol Arhgef10l
Ensembl Gene ENSMUSG00000040964
Gene NameRho guanine nucleotide exchange factor (GEF) 10-like
Synonyms2810441C07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location140514485-140666012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140544419 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 548 (F548S)
Ref Sequence ENSEMBL: ENSMUSP00000101423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039204] [ENSMUST00000069623] [ENSMUST00000097820] [ENSMUST00000105797] [ENSMUST00000105798] [ENSMUST00000105799] [ENSMUST00000140403]
Predicted Effect probably damaging
Transcript: ENSMUST00000039204
AA Change: F835S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040531
Gene: ENSMUSG00000040964
AA Change: F835S

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 318 500 1.95e-52 SMART
Blast:PH 535 748 3e-82 BLAST
low complexity region 821 833 N/A INTRINSIC
low complexity region 864 876 N/A INTRINSIC
Blast:WD40 1217 1270 8e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000069623
AA Change: F801S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066249
Gene: ENSMUSG00000040964
AA Change: F801S

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 279 461 1.95e-52 SMART
Blast:PH 496 714 5e-80 BLAST
low complexity region 787 799 N/A INTRINSIC
low complexity region 830 842 N/A INTRINSIC
Blast:WD40 1183 1236 7e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000097820
AA Change: F796S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095431
Gene: ENSMUSG00000040964
AA Change: F796S

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 279 461 1.95e-52 SMART
Blast:PH 496 709 3e-82 BLAST
low complexity region 782 794 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
Blast:WD40 1178 1231 6e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105797
AA Change: F548S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101423
Gene: ENSMUSG00000040964
AA Change: F548S

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
Pfam:RhoGEF 101 183 7.1e-15 PFAM
low complexity region 195 213 N/A INTRINSIC
Blast:PH 248 461 7e-83 BLAST
low complexity region 534 546 N/A INTRINSIC
low complexity region 577 589 N/A INTRINSIC
Blast:WD40 618 656 6e-15 BLAST
Blast:WD40 930 983 1e-17 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000105798
AA Change: F600S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101424
Gene: ENSMUSG00000040964
AA Change: F600S

DomainStartEndE-ValueType
RhoGEF 78 260 1.95e-52 SMART
Blast:PH 295 513 8e-81 BLAST
low complexity region 586 598 N/A INTRINSIC
low complexity region 629 641 N/A INTRINSIC
Blast:WD40 982 1035 6e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000105799
AA Change: F840S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101425
Gene: ENSMUSG00000040964
AA Change: F840S

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 318 500 1.95e-52 SMART
Blast:PH 535 753 5e-80 BLAST
low complexity region 826 838 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Blast:WD40 1222 1275 8e-18 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000119471
Gene: ENSMUSG00000040964
AA Change: F380S

DomainStartEndE-ValueType
Pfam:RhoGEF 1 46 3.1e-11 PFAM
Blast:PH 81 294 3e-86 BLAST
low complexity region 367 379 N/A INTRINSIC
Blast:WD40 387 446 8e-6 BLAST
Blast:WD40 451 489 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000140403
SMART Domains Protein: ENSMUSP00000117038
Gene: ENSMUSG00000040964

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Blast:PH 16 127 3e-57 BLAST
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the RhoGEF subfamily of RhoGTPases. Members of this subfamily are activated by specific guanine nucleotide exchange factors (GEFs) and are involved in signal transduction. The encoded protein shows cytosolic distribution. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Arhgef10l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Arhgef10l APN 4 140570338 missense probably damaging 0.98
IGL01732:Arhgef10l APN 4 140580415 missense probably damaging 0.99
IGL01988:Arhgef10l APN 4 140578361 splice site probably benign
IGL02031:Arhgef10l APN 4 140575345 missense probably damaging 1.00
IGL02253:Arhgef10l APN 4 140544284 nonsense probably null
IGL02445:Arhgef10l APN 4 140547007 missense probably benign 0.19
IGL02619:Arhgef10l APN 4 140594193 missense probably benign 0.07
IGL02798:Arhgef10l APN 4 140565130 critical splice donor site probably null
IGL03064:Arhgef10l APN 4 140579279 missense probably damaging 1.00
IGL03178:Arhgef10l APN 4 140544428 missense possibly damaging 0.92
IGL03236:Arhgef10l APN 4 140611360 missense probably damaging 1.00
IGL03352:Arhgef10l APN 4 140583931 start codon destroyed probably null 0.99
PIT4494001:Arhgef10l UTSW 4 140565211 missense probably damaging 0.98
R0057:Arhgef10l UTSW 4 140611218 splice site probably benign
R0062:Arhgef10l UTSW 4 140552532 missense probably damaging 1.00
R0109:Arhgef10l UTSW 4 140578294 missense probably benign 0.02
R0109:Arhgef10l UTSW 4 140578294 missense probably benign 0.02
R0114:Arhgef10l UTSW 4 140583883 missense probably benign 0.17
R0334:Arhgef10l UTSW 4 140583926 nonsense probably null
R0742:Arhgef10l UTSW 4 140536845 missense probably damaging 1.00
R1017:Arhgef10l UTSW 4 140515306 missense probably damaging 0.99
R1166:Arhgef10l UTSW 4 140575270 unclassified probably benign
R1397:Arhgef10l UTSW 4 140544443 missense probably damaging 0.98
R1521:Arhgef10l UTSW 4 140515438 missense possibly damaging 0.95
R1707:Arhgef10l UTSW 4 140564289 missense probably damaging 1.00
R1793:Arhgef10l UTSW 4 140515373 missense probably damaging 0.97
R2018:Arhgef10l UTSW 4 140544384 missense probably damaging 1.00
R2093:Arhgef10l UTSW 4 140570290 missense possibly damaging 0.57
R2098:Arhgef10l UTSW 4 140579432 missense probably damaging 1.00
R2310:Arhgef10l UTSW 4 140593118 missense probably damaging 1.00
R2879:Arhgef10l UTSW 4 140515287 missense probably benign 0.09
R2883:Arhgef10l UTSW 4 140516802 missense probably benign 0.02
R3732:Arhgef10l UTSW 4 140581619 small deletion probably benign
R3732:Arhgef10l UTSW 4 140581619 small deletion probably benign
R3861:Arhgef10l UTSW 4 140515487 missense possibly damaging 0.94
R4049:Arhgef10l UTSW 4 140515451 missense probably benign 0.05
R4322:Arhgef10l UTSW 4 140542726 missense probably benign 0.07
R4707:Arhgef10l UTSW 4 140536883 missense possibly damaging 0.63
R5395:Arhgef10l UTSW 4 140570290 missense probably benign 0.16
R5720:Arhgef10l UTSW 4 140581619 small deletion probably benign
R6066:Arhgef10l UTSW 4 140577080 missense probably damaging 1.00
R6190:Arhgef10l UTSW 4 140542762 missense possibly damaging 0.90
R6464:Arhgef10l UTSW 4 140586815 missense probably benign 0.05
R6476:Arhgef10l UTSW 4 140611382 missense probably damaging 1.00
R6478:Arhgef10l UTSW 4 140542757 missense possibly damaging 0.91
R6483:Arhgef10l UTSW 4 140616915 missense probably damaging 0.99
R6631:Arhgef10l UTSW 4 140517747 intron probably benign
R6721:Arhgef10l UTSW 4 140570344 missense probably damaging 1.00
R7098:Arhgef10l UTSW 4 140580911 missense probably benign 0.01
R7100:Arhgef10l UTSW 4 140516815 missense possibly damaging 0.60
R7117:Arhgef10l UTSW 4 140564186 critical splice donor site probably null
Z1088:Arhgef10l UTSW 4 140581735 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CAGTCCAAGGCAGACAGTGG -3'
(R):5'- CTCCATCACTATCCCTGAGAGC -3'

Sequencing Primer
(F):5'- AGTGGGATGCACTGTGACC -3'
(R):5'- ATATGTCTGTGTGCATATTTCCTCTG -3'
Posted On2018-10-18