Incidental Mutation 'R6890:Olfr1480'
ID537178
Institutional Source Beutler Lab
Gene Symbol Olfr1480
Ensembl Gene ENSMUSG00000095484
Gene Nameolfactory receptor 1480
SynonymsMOR202-44, GA_x6K02T2RE5P-3862389-3863336
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13527913-13531275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13530081 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 180 (T180I)
Ref Sequence ENSEMBL: ENSMUSP00000146931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072219] [ENSMUST00000207093] [ENSMUST00000207904] [ENSMUST00000207987]
Predicted Effect probably damaging
Transcript: ENSMUST00000072219
AA Change: T136I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072076
Gene: ENSMUSG00000095484
AA Change: T136I

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 8.2e-54 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.6e-6 PFAM
Pfam:7tm_1 40 289 4.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207093
AA Change: T136I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000207904
AA Change: T136I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000207987
AA Change: T180I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Olfr1480
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr1480 APN 19 13529850 missense probably damaging 1.00
IGL01446:Olfr1480 APN 19 13530252 missense probably benign 0.00
IGL02300:Olfr1480 APN 19 13529880 missense probably damaging 1.00
IGL02689:Olfr1480 APN 19 13529807 missense probably benign 0.34
IGL03119:Olfr1480 APN 19 13530435 missense probably benign 0.11
R0636:Olfr1480 UTSW 19 13530249 missense possibly damaging 0.89
R1665:Olfr1480 UTSW 19 13529838 missense probably damaging 1.00
R1708:Olfr1480 UTSW 19 13529913 missense probably damaging 1.00
R2100:Olfr1480 UTSW 19 13530434 missense probably benign 0.02
R2137:Olfr1480 UTSW 19 13530438 missense probably damaging 0.98
R3879:Olfr1480 UTSW 19 13530249 missense probably damaging 1.00
R3949:Olfr1480 UTSW 19 13530020 missense probably damaging 0.99
R4780:Olfr1480 UTSW 19 13529955 missense probably benign 0.30
R4953:Olfr1480 UTSW 19 13529814 missense probably null 1.00
R5075:Olfr1480 UTSW 19 13530273 missense probably benign 0.17
R5133:Olfr1480 UTSW 19 13530078 missense probably damaging 1.00
R5656:Olfr1480 UTSW 19 13530380 missense probably benign
R6853:Olfr1480 UTSW 19 13529931 missense possibly damaging 0.48
Z1088:Olfr1480 UTSW 19 13529852 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GTGTTTATGCCTCAGCTGTCAC -3'
(R):5'- TGAATGCTGCCAACATAAAGAG -3'

Sequencing Primer
(F):5'- CCCCCAAGGTGATGGAAGG -3'
(R):5'- GCTGCCAACATAAAGAGTATAATTTC -3'
Posted On2018-10-18