Incidental Mutation 'R6815:Lrig1'
ID537273
Institutional Source Beutler Lab
Gene Symbol Lrig1
Ensembl Gene ENSMUSG00000030029
Gene Nameleucine-rich repeats and immunoglobulin-like domains 1
SynonymsLIG-1, Img
MMRRC Submission
Accession Numbers

Genbank: NM_008377; MGI: 107935

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6815 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location94604529-94700158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94625029 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 281 (L281P)
Ref Sequence ENSEMBL: ENSMUSP00000144963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032105] [ENSMUST00000101126] [ENSMUST00000204645]
Predicted Effect probably damaging
Transcript: ENSMUST00000032105
AA Change: L281P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032105
Gene: ENSMUSG00000030029
AA Change: L281P

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101126
AA Change: L281P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098686
Gene: ENSMUSG00000030029
AA Change: L281P

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204645
AA Change: L281P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144963
Gene: ENSMUSG00000030029
AA Change: L281P

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 2675424
PHENOTYPE: Homozygous null mice developed psoriasiform epidermal hyperplasia. Homozygotes exhibit hair follicle, epidermis, vertebral, eye and hearing abnormalities, decreased body size and fat amount, and increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T G 14: 54,591,153 N297T probably damaging Het
6820408C15Rik A G 2: 152,441,055 N251S probably benign Het
Abcc5 T C 16: 20,333,630 T1389A probably damaging Het
Acad11 A G 9: 104,081,327 T265A probably benign Het
Ace3 C T 11: 105,997,258 Q302* probably null Het
Aip A T 19: 4,116,066 H128Q probably benign Het
Akr1b7 A T 6: 34,412,334 probably null Het
Arid4a T A 12: 71,017,082 probably null Het
Armh1 T A 4: 117,229,937 H177L probably damaging Het
Aspm A G 1: 139,480,142 T2256A probably benign Het
Bco1 A T 8: 117,113,522 M260L probably benign Het
Ccdc110 A G 8: 45,941,987 N305S probably benign Het
Ccdc158 T A 5: 92,612,486 Y1035F probably damaging Het
Cd180 C T 13: 102,705,429 L328F probably damaging Het
Cntrl T C 2: 35,149,491 L1121P probably damaging Het
Cyp2u1 A C 3: 131,298,010 I287S probably damaging Het
Dnah3 C T 7: 119,971,727 M2195I probably benign Het
Dnajc21 C T 15: 10,447,691 probably null Het
Dock10 C T 1: 80,538,859 V1398M possibly damaging Het
Dpy19l3 T A 7: 35,749,847 I44F possibly damaging Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc4 T C 16: 13,123,435 I139T probably damaging Het
Gpr4 T A 7: 19,222,635 F161I probably damaging Het
Gucy2e A C 11: 69,232,001 L516R possibly damaging Het
Hdhd5 A G 6: 120,521,209 V143A probably benign Het
Heatr4 T A 12: 83,979,727 Q252L probably damaging Het
Heatr5a T G 12: 51,955,508 D215A possibly damaging Het
Hipk2 G T 6: 38,818,842 A164D probably damaging Het
Igsf11 A G 16: 39,008,881 I46V probably benign Het
Iqgap1 C T 7: 80,766,884 probably null Het
Olfr850 G T 9: 19,477,765 H159N probably benign Het
Olfr9 A G 10: 128,990,322 S137G probably benign Het
Pcdha7 A G 18: 36,975,121 T400A probably damaging Het
Pde5a A G 3: 122,824,924 T629A probably benign Het
Pkhd1l1 A G 15: 44,562,655 D3204G probably damaging Het
Prkd2 T C 7: 16,843,793 F57S probably benign Het
Prr15l T C 11: 96,934,607 V21A probably damaging Het
Rag2 T A 2: 101,630,555 N403K probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rtl1 C A 12: 109,594,503 D301Y probably damaging Het
Sept14 T C 5: 129,692,987 N215S probably benign Het
Sin3a T A 9: 57,117,540 D1061E probably benign Het
Skint5 T A 4: 113,717,127 probably null Het
Stox2 A T 8: 47,193,101 D441E probably damaging Het
Tmem52b G A 6: 129,516,742 probably null Het
Tpm3-rs7 A G 14: 113,314,860 E62G probably benign Het
Trim54 G T 5: 31,134,080 V182L probably damaging Het
Trmt6 A C 2: 132,809,858 V214G probably damaging Het
Ttc21b T C 2: 66,226,790 S613G probably benign Het
Ttll4 C A 1: 74,679,349 R120S possibly damaging Het
Wdr41 A T 13: 95,018,174 K354N probably damaging Het
Zfp652 A T 11: 95,749,404 K52* probably null Het
Other mutations in Lrig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Lrig1 APN 6 94611404 missense probably damaging 0.99
IGL01356:Lrig1 APN 6 94654920 missense probably benign 0.00
IGL01356:Lrig1 APN 6 94609893 missense probably damaging 1.00
IGL02001:Lrig1 APN 6 94607324 missense probably benign 0.00
IGL02019:Lrig1 APN 6 94616429 missense probably damaging 0.98
IGL02177:Lrig1 APN 6 94663996 missense possibly damaging 0.76
IGL02274:Lrig1 APN 6 94663938 missense possibly damaging 0.90
IGL03197:Lrig1 APN 6 94606118 missense probably benign
IGL03263:Lrig1 APN 6 94611647 missense probably benign 0.00
IGL03327:Lrig1 APN 6 94606123 missense probably benign 0.10
N/A - 293:Lrig1 UTSW 6 94609087 missense probably benign
R0019:Lrig1 UTSW 6 94607349 nonsense probably null
R0019:Lrig1 UTSW 6 94607349 nonsense probably null
R0961:Lrig1 UTSW 6 94663914 splice site probably benign
R1018:Lrig1 UTSW 6 94622602 splice site probably benign
R1381:Lrig1 UTSW 6 94606130 missense probably benign 0.04
R1473:Lrig1 UTSW 6 94607313 missense probably benign 0.16
R1498:Lrig1 UTSW 6 94627987 missense possibly damaging 0.89
R1888:Lrig1 UTSW 6 94654878 missense probably benign 0.03
R1888:Lrig1 UTSW 6 94654878 missense probably benign 0.03
R2273:Lrig1 UTSW 6 94608143 missense probably damaging 1.00
R2513:Lrig1 UTSW 6 94617366 intron probably null
R3001:Lrig1 UTSW 6 94608777 missense probably damaging 1.00
R3002:Lrig1 UTSW 6 94608777 missense probably damaging 1.00
R3732:Lrig1 UTSW 6 94611576 missense possibly damaging 0.86
R3732:Lrig1 UTSW 6 94611576 missense possibly damaging 0.86
R3733:Lrig1 UTSW 6 94611576 missense possibly damaging 0.86
R3772:Lrig1 UTSW 6 94605817 missense probably benign 0.00
R4089:Lrig1 UTSW 6 94609859 missense possibly damaging 0.83
R4093:Lrig1 UTSW 6 94613578 missense probably benign 0.10
R4095:Lrig1 UTSW 6 94613578 missense probably benign 0.10
R4225:Lrig1 UTSW 6 94622658 missense probably damaging 1.00
R4917:Lrig1 UTSW 6 94609719 missense probably damaging 1.00
R4951:Lrig1 UTSW 6 94663978 missense probably damaging 1.00
R4976:Lrig1 UTSW 6 94625062 missense probably damaging 1.00
R5000:Lrig1 UTSW 6 94611449 missense probably damaging 1.00
R5149:Lrig1 UTSW 6 94628044 missense possibly damaging 0.93
R5732:Lrig1 UTSW 6 94699539 nonsense probably null
R5988:Lrig1 UTSW 6 94628042 missense probably damaging 0.99
R6064:Lrig1 UTSW 6 94626447 missense probably damaging 1.00
R6292:Lrig1 UTSW 6 94616445 missense probably damaging 1.00
R6723:Lrig1 UTSW 6 94626405 missense probably damaging 1.00
R6889:Lrig1 UTSW 6 94625063 missense probably benign 0.07
R6995:Lrig1 UTSW 6 94611629 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCAGCTCCAAGTCTAAGACCTG -3'
(R):5'- CTTTGAGCGGTAGGAGAAAGTC -3'

Sequencing Primer
(F):5'- CAAGTCTAAGACCTGGCGGG -3'
(R):5'- TCAGATGGACCAAAGCAAGATCTG -3'
Posted On2018-10-18