Incidental Mutation 'R6815:Zfp652'
ID537290
Institutional Source Beutler Lab
Gene Symbol Zfp652
Ensembl Gene ENSMUSG00000075595
Gene Namezinc finger protein 652
Synonyms9530033F24Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_201609.2; MGI:2442221

Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock #R6815 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location95712673-95835115 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 95749404 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 52 (K52*)
Ref Sequence ENSEMBL: ENSMUSP00000115393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091565] [ENSMUST00000107717] [ENSMUST00000133070] [ENSMUST00000148945]
Predicted Effect probably null
Transcript: ENSMUST00000091565
AA Change: K52*
SMART Domains Protein: ENSMUSP00000089153
Gene: ENSMUSG00000075595
AA Change: K52*

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
ZnF_C2H2 440 462 1.15e-5 SMART
ZnF_C2H2 468 488 6.15e1 SMART
low complexity region 508 529 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107717
AA Change: K52*
SMART Domains Protein: ENSMUSP00000103345
Gene: ENSMUSG00000075595
AA Change: K52*

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
ZnF_C2H2 440 462 1.15e-5 SMART
ZnF_C2H2 468 488 6.15e1 SMART
low complexity region 508 529 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000133070
AA Change: K52*
SMART Domains Protein: ENSMUSP00000122280
Gene: ENSMUSG00000075595
AA Change: K52*

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000148945
AA Change: K52*
SMART Domains Protein: ENSMUSP00000115393
Gene: ENSMUSG00000075595
AA Change: K52*

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
ZnF_C2H2 118 141 4.34e-1 SMART
ZnF_C2H2 148 170 2.53e-2 SMART
ZnF_C2H2 176 198 6.78e-3 SMART
ZnF_C2H2 204 226 2.95e-3 SMART
ZnF_C2H2 232 254 1.95e-3 SMART
ZnF_C2H2 260 282 1.15e-5 SMART
ZnF_C2H2 288 308 6.15e1 SMART
low complexity region 328 349 N/A INTRINSIC
low complexity region 364 396 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI

All alleles(23) : Targeted(1) Gene trapped(22)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T G 14: 54,591,153 N297T probably damaging Het
6820408C15Rik A G 2: 152,441,055 N251S probably benign Het
Abcc5 T C 16: 20,333,630 T1389A probably damaging Het
Acad11 A G 9: 104,081,327 T265A probably benign Het
Ace3 C T 11: 105,997,258 Q302* probably null Het
Aip A T 19: 4,116,066 H128Q probably benign Het
Akr1b7 A T 6: 34,412,334 probably null Het
Arid4a T A 12: 71,017,082 probably null Het
Armh1 T A 4: 117,229,937 H177L probably damaging Het
Aspm A G 1: 139,480,142 T2256A probably benign Het
Bco1 A T 8: 117,113,522 M260L probably benign Het
Ccdc110 A G 8: 45,941,987 N305S probably benign Het
Ccdc158 T A 5: 92,612,486 Y1035F probably damaging Het
Cd180 C T 13: 102,705,429 L328F probably damaging Het
Cntrl T C 2: 35,149,491 L1121P probably damaging Het
Cyp2u1 A C 3: 131,298,010 I287S probably damaging Het
Dnah3 C T 7: 119,971,727 M2195I probably benign Het
Dnajc21 C T 15: 10,447,691 probably null Het
Dock10 C T 1: 80,538,859 V1398M possibly damaging Het
Dpy19l3 T A 7: 35,749,847 I44F possibly damaging Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc4 T C 16: 13,123,435 I139T probably damaging Het
Gpr4 T A 7: 19,222,635 F161I probably damaging Het
Gucy2e A C 11: 69,232,001 L516R possibly damaging Het
Hdhd5 A G 6: 120,521,209 V143A probably benign Het
Heatr4 T A 12: 83,979,727 Q252L probably damaging Het
Heatr5a T G 12: 51,955,508 D215A possibly damaging Het
Hipk2 G T 6: 38,818,842 A164D probably damaging Het
Igsf11 A G 16: 39,008,881 I46V probably benign Het
Iqgap1 C T 7: 80,766,884 probably null Het
Lrig1 A G 6: 94,625,029 L281P probably damaging Het
Olfr850 G T 9: 19,477,765 H159N probably benign Het
Olfr9 A G 10: 128,990,322 S137G probably benign Het
Pcdha7 A G 18: 36,975,121 T400A probably damaging Het
Pde5a A G 3: 122,824,924 T629A probably benign Het
Pkhd1l1 A G 15: 44,562,655 D3204G probably damaging Het
Prkd2 T C 7: 16,843,793 F57S probably benign Het
Prr15l T C 11: 96,934,607 V21A probably damaging Het
Rag2 T A 2: 101,630,555 N403K probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rtl1 C A 12: 109,594,503 D301Y probably damaging Het
Sept14 T C 5: 129,692,987 N215S probably benign Het
Sin3a T A 9: 57,117,540 D1061E probably benign Het
Skint5 T A 4: 113,717,127 probably null Het
Stox2 A T 8: 47,193,101 D441E probably damaging Het
Tmem52b G A 6: 129,516,742 probably null Het
Tpm3-rs7 A G 14: 113,314,860 E62G probably benign Het
Trim54 G T 5: 31,134,080 V182L probably damaging Het
Trmt6 A C 2: 132,809,858 V214G probably damaging Het
Ttc21b T C 2: 66,226,790 S613G probably benign Het
Ttll4 C A 1: 74,679,349 R120S possibly damaging Het
Wdr41 A T 13: 95,018,174 K354N probably damaging Het
Other mutations in Zfp652
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0023:Zfp652 UTSW 11 95753469 nonsense probably null
R0023:Zfp652 UTSW 11 95753469 nonsense probably null
R0432:Zfp652 UTSW 11 95763739 missense possibly damaging 0.50
R0464:Zfp652 UTSW 11 95763649 missense probably damaging 0.99
R1146:Zfp652 UTSW 11 95749782 missense possibly damaging 0.86
R1146:Zfp652 UTSW 11 95749782 missense possibly damaging 0.86
R1920:Zfp652 UTSW 11 95764025 missense possibly damaging 0.73
R1922:Zfp652 UTSW 11 95764025 missense possibly damaging 0.73
R2090:Zfp652 UTSW 11 95754008 missense probably benign 0.14
R2290:Zfp652 UTSW 11 95750023 missense possibly damaging 0.58
R2656:Zfp652 UTSW 11 95749329 missense probably damaging 0.98
R4790:Zfp652 UTSW 11 95749609 missense probably damaging 0.99
R5073:Zfp652 UTSW 11 95750064 missense possibly damaging 0.65
R5098:Zfp652 UTSW 11 95752936 missense probably damaging 1.00
R5209:Zfp652 UTSW 11 95763665 missense possibly damaging 0.66
R5569:Zfp652 UTSW 11 95749290 missense probably benign
R5905:Zfp652 UTSW 11 95749863 missense probably benign
R6026:Zfp652 UTSW 11 95749962 missense possibly damaging 0.95
R6054:Zfp652 UTSW 11 95749863 missense probably benign
R6629:Zfp652 UTSW 11 95763790 missense probably damaging 0.96
R6932:Zfp652 UTSW 11 95763841 missense probably benign
R7384:Zfp652 UTSW 11 95753004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCCACTTCCTAATGAGC -3'
(R):5'- GAAGAGACACCCTTTTCCCC -3'

Sequencing Primer
(F):5'- GCTACACAGCCAGTCCTTG -3'
(R):5'- ATGATCTGCTCCCTTTTGTAAGAGAC -3'
Posted On2018-10-18