Incidental Mutation 'R6815:Wdr41'
ID537297
Institutional Source Beutler Lab
Gene Symbol Wdr41
Ensembl Gene ENSMUSG00000042015
Gene NameWD repeat domain 41
SynonymsB830029I03Rik, MSTP048
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6815 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location94976344-95023314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95018174 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 354 (K354N)
Ref Sequence ENSEMBL: ENSMUSP00000124033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056512] [ENSMUST00000159647] [ENSMUST00000160115] [ENSMUST00000160801] [ENSMUST00000167155]
Predicted Effect probably damaging
Transcript: ENSMUST00000056512
AA Change: K354N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055145
Gene: ENSMUSG00000042015
AA Change: K354N

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
WD40 211 249 2.86e0 SMART
WD40 308 350 7.92e-3 SMART
WD40 394 432 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159647
SMART Domains Protein: ENSMUSP00000138501
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 9e-6 BLAST
internal_repeat_1 233 260 6.23e-8 PROSPERO
internal_repeat_1 269 309 6.23e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000160115
SMART Domains Protein: ENSMUSP00000138543
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 1e-5 BLAST
internal_repeat_2 224 281 1.46e-11 PROSPERO
internal_repeat_1 233 315 2.35e-20 PROSPERO
internal_repeat_2 306 365 1.46e-11 PROSPERO
internal_repeat_1 353 435 2.35e-20 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000160801
AA Change: K354N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124033
Gene: ENSMUSG00000042015
AA Change: K354N

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
WD40 211 249 2.86e0 SMART
WD40 308 350 7.92e-3 SMART
WD40 394 432 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167155
SMART Domains Protein: ENSMUSP00000129595
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 9e-6 BLAST
internal_repeat_1 233 260 6.23e-8 PROSPERO
internal_repeat_1 269 309 6.23e-8 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein of unknown function, but which contains a WD40 domain consisting of six WD40 repeats. The WD40 domain is one of the most abundant protein domains in eukaryotes, and is found in proteins with widely varying cellular functions. However, proteins with this domain often provide a rigid scaffold for protein-protein interactions. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T G 14: 54,591,153 N297T probably damaging Het
6820408C15Rik A G 2: 152,441,055 N251S probably benign Het
Abcc5 T C 16: 20,333,630 T1389A probably damaging Het
Acad11 A G 9: 104,081,327 T265A probably benign Het
Ace3 C T 11: 105,997,258 Q302* probably null Het
Aip A T 19: 4,116,066 H128Q probably benign Het
Akr1b7 A T 6: 34,412,334 probably null Het
Arid4a T A 12: 71,017,082 probably null Het
Armh1 T A 4: 117,229,937 H177L probably damaging Het
Aspm A G 1: 139,480,142 T2256A probably benign Het
Bco1 A T 8: 117,113,522 M260L probably benign Het
Ccdc110 A G 8: 45,941,987 N305S probably benign Het
Ccdc158 T A 5: 92,612,486 Y1035F probably damaging Het
Cd180 C T 13: 102,705,429 L328F probably damaging Het
Cntrl T C 2: 35,149,491 L1121P probably damaging Het
Cyp2u1 A C 3: 131,298,010 I287S probably damaging Het
Dnah3 C T 7: 119,971,727 M2195I probably benign Het
Dnajc21 C T 15: 10,447,691 probably null Het
Dock10 C T 1: 80,538,859 V1398M possibly damaging Het
Dpy19l3 T A 7: 35,749,847 I44F possibly damaging Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc4 T C 16: 13,123,435 I139T probably damaging Het
Gpr4 T A 7: 19,222,635 F161I probably damaging Het
Gucy2e A C 11: 69,232,001 L516R possibly damaging Het
Hdhd5 A G 6: 120,521,209 V143A probably benign Het
Heatr4 T A 12: 83,979,727 Q252L probably damaging Het
Heatr5a T G 12: 51,955,508 D215A possibly damaging Het
Hipk2 G T 6: 38,818,842 A164D probably damaging Het
Igsf11 A G 16: 39,008,881 I46V probably benign Het
Iqgap1 C T 7: 80,766,884 probably null Het
Lrig1 A G 6: 94,625,029 L281P probably damaging Het
Olfr850 G T 9: 19,477,765 H159N probably benign Het
Olfr9 A G 10: 128,990,322 S137G probably benign Het
Pcdha7 A G 18: 36,975,121 T400A probably damaging Het
Pde5a A G 3: 122,824,924 T629A probably benign Het
Pkhd1l1 A G 15: 44,562,655 D3204G probably damaging Het
Prkd2 T C 7: 16,843,793 F57S probably benign Het
Prr15l T C 11: 96,934,607 V21A probably damaging Het
Rag2 T A 2: 101,630,555 N403K probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rtl1 C A 12: 109,594,503 D301Y probably damaging Het
Sept14 T C 5: 129,692,987 N215S probably benign Het
Sin3a T A 9: 57,117,540 D1061E probably benign Het
Skint5 T A 4: 113,717,127 probably null Het
Stox2 A T 8: 47,193,101 D441E probably damaging Het
Tmem52b G A 6: 129,516,742 probably null Het
Tpm3-rs7 A G 14: 113,314,860 E62G probably benign Het
Trim54 G T 5: 31,134,080 V182L probably damaging Het
Trmt6 A C 2: 132,809,858 V214G probably damaging Het
Ttc21b T C 2: 66,226,790 S613G probably benign Het
Ttll4 C A 1: 74,679,349 R120S possibly damaging Het
Zfp652 A T 11: 95,749,404 K52* probably null Het
Other mutations in Wdr41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Wdr41 APN 13 95017456 unclassified probably benign
IGL02813:Wdr41 APN 13 94995245 splice site probably null
gogi UTSW 13 95015217 critical splice donor site probably null
metallica UTSW 13 95015174 nonsense probably null
R0047:Wdr41 UTSW 13 95010287 missense probably damaging 1.00
R0110:Wdr41 UTSW 13 95018111 unclassified probably benign
R0243:Wdr41 UTSW 13 95017406 missense probably damaging 1.00
R0537:Wdr41 UTSW 13 94995305 splice site probably benign
R2025:Wdr41 UTSW 13 95018948 missense probably damaging 1.00
R2116:Wdr41 UTSW 13 95015029 critical splice acceptor site probably null
R3953:Wdr41 UTSW 13 94997063 missense probably damaging 1.00
R4886:Wdr41 UTSW 13 95015174 nonsense probably null
R5055:Wdr41 UTSW 13 95015217 critical splice donor site probably null
R5266:Wdr41 UTSW 13 94995251 missense probably damaging 1.00
R5276:Wdr41 UTSW 13 95017450 critical splice donor site probably null
R5738:Wdr41 UTSW 13 94978488 missense possibly damaging 0.55
R5957:Wdr41 UTSW 13 94997187 critical splice donor site probably null
R6682:Wdr41 UTSW 13 95013131 missense probably damaging 1.00
R6817:Wdr41 UTSW 13 94997304 intron probably null
Predicted Primers PCR Primer
(F):5'- TGTTAACCTGTGACGGTCGG -3'
(R):5'- TGTCTGATTCCTACGCAGAGC -3'

Sequencing Primer
(F):5'- CTGTGACGGTCGGCCTTG -3'
(R):5'- CCTACGCAGAGCATATTCTATATGG -3'
Posted On2018-10-18