Incidental Mutation 'R6815:Abcc5'
ID537304
Institutional Source Beutler Lab
Gene Symbol Abcc5
Ensembl Gene ENSMUSG00000022822
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 5
Synonyms2900011L11Rik, Abcc5a, Mrp5, Abcc5b
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_013790.2, NM_176839.1; MGI:1351644

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6815 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location20331303-20426394 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20333630 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1389 (T1389A)
Ref Sequence ENSEMBL: ENSMUSP00000111209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079158] [ENSMUST00000115547]
Predicted Effect probably damaging
Transcript: ENSMUST00000079158
AA Change: T1389A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078158
Gene: ENSMUSG00000022822
AA Change: T1389A

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 1.6e-18 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1142 9.3e-36 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115547
AA Change: T1389A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111209
Gene: ENSMUSG00000022822
AA Change: T1389A

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 2e-17 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1146 6.5e-30 PFAM
AAA 1218 1403 1.26e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 3794119
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that the human protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display normal cGMP transport into erythrocyte membrane vesicles. [provided by MGI curators]
Allele List at MGI

All alleles(81) : Targeted(4) Gene trapped(77)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T G 14: 54,591,153 N297T probably damaging Het
6820408C15Rik A G 2: 152,441,055 N251S probably benign Het
Acad11 A G 9: 104,081,327 T265A probably benign Het
Ace3 C T 11: 105,997,258 Q302* probably null Het
Aip A T 19: 4,116,066 H128Q probably benign Het
Akr1b7 A T 6: 34,412,334 probably null Het
Arid4a T A 12: 71,017,082 probably null Het
Armh1 T A 4: 117,229,937 H177L probably damaging Het
Aspm A G 1: 139,480,142 T2256A probably benign Het
Bco1 A T 8: 117,113,522 M260L probably benign Het
Ccdc110 A G 8: 45,941,987 N305S probably benign Het
Ccdc158 T A 5: 92,612,486 Y1035F probably damaging Het
Cd180 C T 13: 102,705,429 L328F probably damaging Het
Cntrl T C 2: 35,149,491 L1121P probably damaging Het
Cyp2u1 A C 3: 131,298,010 I287S probably damaging Het
Dnah3 C T 7: 119,971,727 M2195I probably benign Het
Dnajc21 C T 15: 10,447,691 probably null Het
Dock10 C T 1: 80,538,859 V1398M possibly damaging Het
Dpy19l3 T A 7: 35,749,847 I44F possibly damaging Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc4 T C 16: 13,123,435 I139T probably damaging Het
Gpr4 T A 7: 19,222,635 F161I probably damaging Het
Gucy2e A C 11: 69,232,001 L516R possibly damaging Het
Hdhd5 A G 6: 120,521,209 V143A probably benign Het
Heatr4 T A 12: 83,979,727 Q252L probably damaging Het
Heatr5a T G 12: 51,955,508 D215A possibly damaging Het
Hipk2 G T 6: 38,818,842 A164D probably damaging Het
Igsf11 A G 16: 39,008,881 I46V probably benign Het
Iqgap1 C T 7: 80,766,884 probably null Het
Lrig1 A G 6: 94,625,029 L281P probably damaging Het
Olfr850 G T 9: 19,477,765 H159N probably benign Het
Olfr9 A G 10: 128,990,322 S137G probably benign Het
Pcdha7 A G 18: 36,975,121 T400A probably damaging Het
Pde5a A G 3: 122,824,924 T629A probably benign Het
Pkhd1l1 A G 15: 44,562,655 D3204G probably damaging Het
Prkd2 T C 7: 16,843,793 F57S probably benign Het
Prr15l T C 11: 96,934,607 V21A probably damaging Het
Rag2 T A 2: 101,630,555 N403K probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rtl1 C A 12: 109,594,503 D301Y probably damaging Het
Sept14 T C 5: 129,692,987 N215S probably benign Het
Sin3a T A 9: 57,117,540 D1061E probably benign Het
Skint5 T A 4: 113,717,127 probably null Het
Stox2 A T 8: 47,193,101 D441E probably damaging Het
Tmem52b G A 6: 129,516,742 probably null Het
Tpm3-rs7 A G 14: 113,314,860 E62G probably benign Het
Trim54 G T 5: 31,134,080 V182L probably damaging Het
Trmt6 A C 2: 132,809,858 V214G probably damaging Het
Ttc21b T C 2: 66,226,790 S613G probably benign Het
Ttll4 C A 1: 74,679,349 R120S possibly damaging Het
Wdr41 A T 13: 95,018,174 K354N probably damaging Het
Zfp652 A T 11: 95,749,404 K52* probably null Het
Other mutations in Abcc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Abcc5 APN 16 20422357 missense probably benign 0.01
IGL00928:Abcc5 APN 16 20398970 unclassified probably benign
IGL01350:Abcc5 APN 16 20368458 missense probably benign 0.00
IGL01774:Abcc5 APN 16 20378457 missense probably damaging 1.00
IGL01934:Abcc5 APN 16 20422441 utr 5 prime probably benign
IGL02413:Abcc5 APN 16 20422437 utr 5 prime probably benign
IGL02426:Abcc5 APN 16 20338925 missense probably damaging 0.98
IGL02797:Abcc5 APN 16 20368464 missense probably benign 0.06
IGL02938:Abcc5 APN 16 20362229 missense possibly damaging 0.64
IGL03367:Abcc5 APN 16 20392811 utr 3 prime probably benign
IGL03411:Abcc5 APN 16 20399560 missense probably damaging 0.97
PIT4508001:Abcc5 UTSW 16 20357378 missense probably damaging 0.97
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0220:Abcc5 UTSW 16 20369102 missense probably benign
R0281:Abcc5 UTSW 16 20422400 missense probably damaging 1.00
R0401:Abcc5 UTSW 16 20376558 missense probably benign 0.09
R0448:Abcc5 UTSW 16 20399937 missense probably damaging 1.00
R0477:Abcc5 UTSW 16 20368569 missense possibly damaging 0.51
R0477:Abcc5 UTSW 16 20398885 missense probably damaging 0.96
R0601:Abcc5 UTSW 16 20404559 splice site probably benign
R0648:Abcc5 UTSW 16 20365882 missense possibly damaging 0.90
R0709:Abcc5 UTSW 16 20376592 missense possibly damaging 0.91
R1144:Abcc5 UTSW 16 20422438 utr 5 prime probably benign
R1552:Abcc5 UTSW 16 20398867 missense probably damaging 0.99
R1625:Abcc5 UTSW 16 20365817 missense probably damaging 0.99
R1748:Abcc5 UTSW 16 20333588 missense probably benign 0.01
R1789:Abcc5 UTSW 16 20365951 missense probably damaging 1.00
R1801:Abcc5 UTSW 16 20338887 missense probably benign 0.43
R1909:Abcc5 UTSW 16 20376509 critical splice donor site probably null
R2046:Abcc5 UTSW 16 20399817 missense possibly damaging 0.90
R2203:Abcc5 UTSW 16 20405882 missense possibly damaging 0.91
R3031:Abcc5 UTSW 16 20375113 missense probably damaging 0.99
R3417:Abcc5 UTSW 16 20405552 splice site probably benign
R3708:Abcc5 UTSW 16 20372180 missense probably benign 0.30
R3731:Abcc5 UTSW 16 20398934 nonsense probably null
R3829:Abcc5 UTSW 16 20365865 missense probably benign 0.00
R3847:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3850:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3955:Abcc5 UTSW 16 20405543 missense probably damaging 0.97
R4072:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4432:Abcc5 UTSW 16 20368187 intron probably null
R4433:Abcc5 UTSW 16 20368187 intron probably null
R4505:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4506:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4715:Abcc5 UTSW 16 20398876 missense probably damaging 1.00
R4739:Abcc5 UTSW 16 20399626 missense probably damaging 1.00
R4866:Abcc5 UTSW 16 20422432 start codon destroyed probably null 1.00
R4905:Abcc5 UTSW 16 20399928 missense probably damaging 1.00
R4907:Abcc5 UTSW 16 20376546 missense possibly damaging 0.86
R5088:Abcc5 UTSW 16 20376662 missense probably damaging 1.00
R5232:Abcc5 UTSW 16 20338922 missense probably damaging 0.96
R5559:Abcc5 UTSW 16 20338886 missense probably damaging 1.00
R5647:Abcc5 UTSW 16 20399847 missense probably damaging 1.00
R5861:Abcc5 UTSW 16 20399894 missense probably damaging 1.00
R6190:Abcc5 UTSW 16 20392779 missense probably benign 0.02
R6213:Abcc5 UTSW 16 20400012 missense probably damaging 1.00
R6511:Abcc5 UTSW 16 20376594 missense probably damaging 0.99
R6732:Abcc5 UTSW 16 20404684 missense probably benign 0.01
R6913:Abcc5 UTSW 16 20378744 missense possibly damaging 0.73
R6945:Abcc5 UTSW 16 20400009 missense probably benign
X0022:Abcc5 UTSW 16 20392587 missense probably damaging 1.00
X0053:Abcc5 UTSW 16 20364042 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCACTGCTCATGTGCCAC -3'
(R):5'- ATGCTTGGGGAAGTAACTGG -3'

Sequencing Primer
(F):5'- TAAGAGCATCCCTGGGGCATAG -3'
(R):5'- AAGTAACTGGATCTGTCTGTCC -3'
Posted On2018-10-18