Incidental Mutation 'R6816:Adgrg5'
ID537338
Institutional Source Beutler Lab
Gene Symbol Adgrg5
Ensembl Gene ENSMUSG00000061577
Gene Nameadhesion G protein-coupled receptor G5
SynonymsGpr114, PGR27, LOC382045
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6816 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location94923694-94943280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94941683 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 458 (T458A)
Ref Sequence ENSEMBL: ENSMUSP00000074155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074570] [ENSMUST00000128308] [ENSMUST00000166802]
Predicted Effect probably damaging
Transcript: ENSMUST00000074570
AA Change: T458A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074155
Gene: ENSMUSG00000061577
AA Change: T458A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 87 95 N/A INTRINSIC
GPS 181 234 4.7e-13 SMART
Pfam:7tm_2 240 494 2.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128308
SMART Domains Protein: ENSMUSP00000120217
Gene: ENSMUSG00000061577

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 83 91 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166802
AA Change: T459A

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132628
Gene: ENSMUSG00000061577
AA Change: T459A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 87 95 N/A INTRINSIC
GPS 181 234 1.37e-14 SMART
Pfam:7tm_2 241 495 1.3e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adhesion family of G-protein coupled receptors. Members of this family are characterized by long N-termini and multiple functional domains. They may play a role in the immune system as well as in the central nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd36 T G 11: 5,643,765 F457V possibly damaging Het
Cep152 T C 2: 125,595,027 E531G probably damaging Het
Dpf1 A C 7: 29,311,662 D162A possibly damaging Het
E2f8 A T 7: 48,875,583 Y214N possibly damaging Het
Fer1l5 A T 1: 36,406,510 Y786F possibly damaging Het
Fhod1 G T 8: 105,330,544 Q933K probably benign Het
Gdap2 T C 3: 100,191,705 probably null Het
Gm6205 A T 5: 94,683,914 Q260L possibly damaging Het
Gm996 C CTCTA 2: 25,579,721 probably null Het
Grin2d A G 7: 45,833,682 probably benign Het
Hgs T A 11: 120,471,571 V112D probably damaging Het
Hist1h2bp C T 13: 21,787,777 S88L probably benign Het
Igf2r A T 17: 12,714,082 V851E probably damaging Het
Igfn1 T A 1: 135,959,728 T2533S probably benign Het
Iqch C T 9: 63,480,759 V750I probably benign Het
Itih2 A G 2: 10,105,706 Y525H probably damaging Het
Kcnu1 C T 8: 25,937,734 Q360* probably null Het
Klk1b26 A G 7: 44,016,868 N245S probably benign Het
Kmt2c T C 5: 25,405,532 probably null Het
Lhpp T C 7: 132,634,033 S116P probably benign Het
Madcam1 A G 10: 79,665,440 D113G probably damaging Het
Magi3 A T 3: 104,089,911 probably null Het
Map3k9 A G 12: 81,722,254 S1007P possibly damaging Het
Mkrn2 C T 6: 115,611,728 P144L probably damaging Het
Mon1a T C 9: 107,900,410 S171P probably damaging Het
Nrarp T C 2: 25,181,307 L66P probably damaging Het
P2ry1 T A 3: 61,003,832 F131I probably benign Het
Pdzk1 A G 3: 96,854,570 Q166R probably benign Het
Pigt G T 2: 164,501,132 V249F probably damaging Het
Ppp1r16b G T 2: 158,761,675 V407L probably benign Het
Rab6a G T 7: 100,629,873 E73D probably damaging Het
Ralb C A 1: 119,477,982 G33* probably null Het
Sema3b T A 9: 107,600,350 M491L probably benign Het
Sema3c A C 5: 17,670,465 D40A probably benign Het
Slc22a1 T C 17: 12,652,483 N464D possibly damaging Het
Spire2 T A 8: 123,359,413 S295T probably benign Het
Stat3 T G 11: 100,911,267 Q32P probably damaging Het
Sulf2 T C 2: 166,082,754 T471A probably benign Het
Sult2b1 A G 7: 45,733,678 W227R probably damaging Het
Syt2 T A 1: 134,745,800 I294N probably damaging Het
Taar8b A T 10: 24,092,181 F38L probably benign Het
Tbl2 T A 5: 135,159,215 probably null Het
Tex48 G A 4: 63,611,955 S9L probably damaging Het
Tmprss2 A T 16: 97,568,467 M369K possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Tspoap1 T C 11: 87,765,665 V263A probably benign Het
Vmn2r74 T A 7: 85,961,413 R24* probably null Het
Wdr35 G A 12: 9,027,724 probably null Het
Zfp202 A G 9: 40,211,813 R624G probably damaging Het
Other mutations in Adgrg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Adgrg5 APN 8 94937629 missense probably damaging 1.00
IGL02617:Adgrg5 APN 8 94933982 missense probably benign 0.01
R0483:Adgrg5 UTSW 8 94933508 missense possibly damaging 0.73
R0539:Adgrg5 UTSW 8 94938632 missense probably damaging 1.00
R0580:Adgrg5 UTSW 8 94937344 critical splice donor site probably null
R0650:Adgrg5 UTSW 8 94934157 critical splice donor site probably null
R0652:Adgrg5 UTSW 8 94934157 critical splice donor site probably null
R0828:Adgrg5 UTSW 8 94941785 splice site probably null
R1546:Adgrg5 UTSW 8 94941630 missense probably benign 0.27
R1567:Adgrg5 UTSW 8 94937698 missense probably damaging 0.97
R1695:Adgrg5 UTSW 8 94937745 missense probably damaging 1.00
R1753:Adgrg5 UTSW 8 94942052 missense possibly damaging 0.65
R1852:Adgrg5 UTSW 8 94937800 missense probably damaging 1.00
R2018:Adgrg5 UTSW 8 94934480 missense probably damaging 1.00
R2051:Adgrg5 UTSW 8 94942067 missense probably benign 0.01
R2190:Adgrg5 UTSW 8 94933951 missense probably damaging 1.00
R2299:Adgrg5 UTSW 8 94938576 missense possibly damaging 0.88
R2568:Adgrg5 UTSW 8 94934021 missense probably damaging 0.99
R4283:Adgrg5 UTSW 8 94937698 missense probably benign 0.21
R4512:Adgrg5 UTSW 8 94934024 missense possibly damaging 0.90
R4825:Adgrg5 UTSW 8 94941734 missense possibly damaging 0.77
R5422:Adgrg5 UTSW 8 94933952 missense probably damaging 1.00
R5427:Adgrg5 UTSW 8 94935102 missense probably benign 0.27
R6186:Adgrg5 UTSW 8 94934024 missense possibly damaging 0.90
R6522:Adgrg5 UTSW 8 94942068 missense probably benign 0.13
R6608:Adgrg5 UTSW 8 94941720 missense probably damaging 1.00
R6810:Adgrg5 UTSW 8 94933942 missense probably damaging 0.97
R7214:Adgrg5 UTSW 8 94934018 missense
X0027:Adgrg5 UTSW 8 94937338 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGGATCCGAAGTCCCATGGTAC -3'
(R):5'- TCTTCTAGGTAAATGTGCCCCTAG -3'

Sequencing Primer
(F):5'- TGGTACACAGCATCCTGGTCATG -3'
(R):5'- TAGGTAAATGTGCCCCTAGACCAG -3'
Posted On2018-10-18