Incidental Mutation 'R6817:Cops5'
ID537357
Institutional Source Beutler Lab
Gene Symbol Cops5
Ensembl Gene ENSMUSG00000025917
Gene NameCOP9 signalosome subunit 5
SynonymsCSN5, JUN activation binding protein, Sgn5, Jab1, COP9 complex S5
MMRRC Submission
Accession Numbers

Genbank: NM_013715; MGI: 1349415

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6817 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location10024601-10038168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10030604 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 256 (L256F)
Ref Sequence ENSEMBL: ENSMUSP00000027050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027050] [ENSMUST00000186528] [ENSMUST00000188619]
Predicted Effect probably benign
Transcript: ENSMUST00000027050
AA Change: L256F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027050
Gene: ENSMUSG00000025917
AA Change: L256F

DomainStartEndE-ValueType
Blast:JAB_MPN 8 49 8e-12 BLAST
JAB_MPN 54 191 1.19e-52 SMART
Blast:JAB_MPN 192 249 5e-30 BLAST
low complexity region 250 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186528
Predicted Effect probably benign
Transcript: ENSMUST00000188619
SMART Domains Protein: ENSMUSP00000140115
Gene: ENSMUSG00000025917

DomainStartEndE-ValueType
JAB_MPN 37 174 5.3e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190155
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein is reported to be involved in the degradation of cyclin-dependent kinase inhibitor CDKN1B/p27Kip1. It is also known to be an coactivator that increases the specificity of JUN/AP1 transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die soon after implantation and exhibit growth-retardation, decrease in cell proliferation, and an increase in cell apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(12)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Arhgap21 A C 2: 20,880,296 L690R probably benign Het
Asxl3 A G 18: 22,523,580 N1549S probably benign Het
Cast T C 13: 74,699,158 T670A possibly damaging Het
Cd109 A G 9: 78,714,955 D1409G probably benign Het
Cemip A G 7: 83,987,992 F311S probably damaging Het
Cfap43 T A 19: 47,756,085 I1210F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cux1 T C 5: 136,373,173 probably null Het
Dab1 A G 4: 104,679,546 K178E probably damaging Het
Ddc A G 11: 11,824,854 Y346H probably damaging Het
Dlg2 T G 7: 91,965,664 D225E probably benign Het
Dsg1b A T 18: 20,394,405 I198F probably damaging Het
Ect2l T C 10: 18,174,059 H155R probably benign Het
Epha2 A G 4: 141,308,994 H247R probably damaging Het
Esrp1 A G 4: 11,357,552 V355A probably damaging Het
Fam78b A G 1: 167,078,850 M193V possibly damaging Het
Gdpd4 A G 7: 97,957,830 T4A probably benign Het
Gm17175 T C 14: 51,573,021 N50D possibly damaging Het
Kcnt2 A G 1: 140,246,193 probably benign Het
Lpo T C 11: 87,809,241 N525D probably benign Het
Lrrc41 G A 4: 116,089,305 E406K possibly damaging Het
Lrrc59 G C 11: 94,630,065 D21H probably damaging Het
Mgat4a G A 1: 37,449,123 R472* probably null Het
Mroh7 C T 4: 106,714,115 A14T probably benign Het
Muc5b T C 7: 141,862,913 S3199P probably benign Het
Muc6 T A 7: 141,651,061 Y270F probably damaging Het
Myo18b T A 5: 112,830,238 T1273S probably benign Het
Nos2 A T 11: 78,945,266 E385V possibly damaging Het
Nsl1 T G 1: 191,063,274 probably null Het
Nup93 T C 8: 94,314,682 probably null Het
Olfr1175-ps A T 2: 88,322,763 M314K probably benign Het
Pcna-ps2 T G 19: 9,283,497 M40R probably damaging Het
Pik3r5 A G 11: 68,486,581 E148G probably damaging Het
Pirt A G 11: 66,925,911 E16G probably damaging Het
Pkp4 T C 2: 59,318,600 Y566H probably damaging Het
Psg17 A C 7: 18,814,640 V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rassf7 A G 7: 141,217,447 E191G probably damaging Het
Rnf213 T C 11: 119,462,285 probably null Het
Slc34a2 C T 5: 53,064,028 T272I probably damaging Het
Sos2 T C 12: 69,618,161 E332G probably benign Het
Spdye4c T C 2: 128,596,510 Y263H probably damaging Het
Tmprss11f C T 5: 86,556,934 V42I probably benign Het
Trpv5 T A 6: 41,658,007 N463Y possibly damaging Het
Ush2a A T 1: 188,862,864 Q3831L probably benign Het
Wdr41 C A 13: 94,997,304 probably null Het
Zfand1 A G 3: 10,340,824 C246R probably benign Het
Other mutations in Cops5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Cops5 APN 1 10034070 missense probably damaging 1.00
IGL01759:Cops5 APN 1 10027249 missense probably damaging 0.99
IGL02141:Cops5 APN 1 10035117 missense probably damaging 1.00
IGL02492:Cops5 APN 1 10027152 missense probably benign
R1491:Cops5 UTSW 1 10034018 missense possibly damaging 0.88
R2055:Cops5 UTSW 1 10032337 critical splice donor site probably null
R4163:Cops5 UTSW 1 10030687 missense probably damaging 1.00
R5945:Cops5 UTSW 1 10038010 utr 5 prime probably benign
R6295:Cops5 UTSW 1 10030695 utr 3 prime probably benign
R6419:Cops5 UTSW 1 10033307 missense probably damaging 1.00
R6487:Cops5 UTSW 1 10037779 missense probably benign 0.13
R7012:Cops5 UTSW 1 10030665 makesense probably null
Predicted Primers PCR Primer
(F):5'- TAGCACTTGCCTGTGATCC -3'
(R):5'- GCTTTGGTGTAGAGAAAACTTCTATCC -3'

Sequencing Primer
(F):5'- TCAAGGCCCTGAAGTCATG -3'
(R):5'- CCTGCCAAATGTGTGCT -3'
Posted On2018-10-18