Incidental Mutation 'R6817:Fam78b'
ID537360
Institutional Source Beutler Lab
Gene Symbol Fam78b
Ensembl Gene ENSMUSG00000060568
Gene Namefamily with sequence similarity 78, member B
SynonymsC030014K22Rik, C030020L09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R6817 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location167001417-167091302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 167078850 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 193 (M193V)
Ref Sequence ENSEMBL: ENSMUSP00000139628 (fasta)
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000126198
AA Change: M193V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000156025
AA Change: M193V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000165874
AA Change: M193V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000190081
AA Change: M193V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Arhgap21 A C 2: 20,880,296 L690R probably benign Het
Asxl3 A G 18: 22,523,580 N1549S probably benign Het
Cast T C 13: 74,699,158 T670A possibly damaging Het
Cd109 A G 9: 78,714,955 D1409G probably benign Het
Cemip A G 7: 83,987,992 F311S probably damaging Het
Cfap43 T A 19: 47,756,085 I1210F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cops5 G A 1: 10,030,604 L256F probably benign Het
Cux1 T C 5: 136,373,173 probably null Het
Dab1 A G 4: 104,679,546 K178E probably damaging Het
Ddc A G 11: 11,824,854 Y346H probably damaging Het
Dlg2 T G 7: 91,965,664 D225E probably benign Het
Dsg1b A T 18: 20,394,405 I198F probably damaging Het
Ect2l T C 10: 18,174,059 H155R probably benign Het
Epha2 A G 4: 141,308,994 H247R probably damaging Het
Esrp1 A G 4: 11,357,552 V355A probably damaging Het
Gdpd4 A G 7: 97,957,830 T4A probably benign Het
Gm17175 T C 14: 51,573,021 N50D possibly damaging Het
Kcnt2 A G 1: 140,246,193 probably benign Het
Lpo T C 11: 87,809,241 N525D probably benign Het
Lrrc41 G A 4: 116,089,305 E406K possibly damaging Het
Lrrc59 G C 11: 94,630,065 D21H probably damaging Het
Mgat4a G A 1: 37,449,123 R472* probably null Het
Mroh7 C T 4: 106,714,115 A14T probably benign Het
Muc5b T C 7: 141,862,913 S3199P probably benign Het
Muc6 T A 7: 141,651,061 Y270F probably damaging Het
Myo18b T A 5: 112,830,238 T1273S probably benign Het
Nos2 A T 11: 78,945,266 E385V possibly damaging Het
Nsl1 T G 1: 191,063,274 probably null Het
Nup93 T C 8: 94,314,682 probably null Het
Olfr1175-ps A T 2: 88,322,763 M314K probably benign Het
Pcna-ps2 T G 19: 9,283,497 M40R probably damaging Het
Pik3r5 A G 11: 68,486,581 E148G probably damaging Het
Pirt A G 11: 66,925,911 E16G probably damaging Het
Pkp4 T C 2: 59,318,600 Y566H probably damaging Het
Psg17 A C 7: 18,814,640 V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rassf7 A G 7: 141,217,447 E191G probably damaging Het
Rnf213 T C 11: 119,462,285 probably null Het
Slc34a2 C T 5: 53,064,028 T272I probably damaging Het
Sos2 T C 12: 69,618,161 E332G probably benign Het
Spdye4c T C 2: 128,596,510 Y263H probably damaging Het
Tmprss11f C T 5: 86,556,934 V42I probably benign Het
Trpv5 T A 6: 41,658,007 N463Y possibly damaging Het
Ush2a A T 1: 188,862,864 Q3831L probably benign Het
Wdr41 C A 13: 94,997,304 probably null Het
Zfand1 A G 3: 10,340,824 C246R probably benign Het
Other mutations in Fam78b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:Fam78b APN 1 167078888 missense probably damaging 1.00
IGL03128:Fam78b APN 1 167078941 missense probably damaging 1.00
IGL03258:Fam78b APN 1 167078754 missense probably damaging 1.00
pacer UTSW 1 167078709 missense probably damaging 1.00
PIT1430001:Fam78b UTSW 1 167001744 missense probably benign 0.12
R1443:Fam78b UTSW 1 167078760 missense probably damaging 0.96
R1475:Fam78b UTSW 1 167001777 missense probably damaging 1.00
R1729:Fam78b UTSW 1 167001630 missense possibly damaging 0.83
R1883:Fam78b UTSW 1 167001602 missense probably benign
R2118:Fam78b UTSW 1 167078709 missense probably damaging 1.00
R2121:Fam78b UTSW 1 167078709 missense probably damaging 1.00
R2122:Fam78b UTSW 1 167078709 missense probably damaging 1.00
R2124:Fam78b UTSW 1 167078709 missense probably damaging 1.00
R2168:Fam78b UTSW 1 167078650 missense probably damaging 1.00
R4152:Fam78b UTSW 1 167078800 missense probably benign 0.19
R4167:Fam78b UTSW 1 167001732 missense possibly damaging 0.67
R4439:Fam78b UTSW 1 167078922 missense probably damaging 0.99
R4441:Fam78b UTSW 1 167078922 missense probably damaging 0.99
R4795:Fam78b UTSW 1 167078647 missense probably benign 0.01
R4796:Fam78b UTSW 1 167078647 missense probably benign 0.01
R6268:Fam78b UTSW 1 167078553 missense probably damaging 1.00
R7195:Fam78b UTSW 1 167078562 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCCGTCAGCATGAATGATAAC -3'
(R):5'- CAGTTGGGCAGTCTGCTTTTAC -3'

Sequencing Primer
(F):5'- TGAATGATAACTTCTACCCCAGCGTG -3'
(R):5'- GCTTTTACTTAGGAGGTATCACAACC -3'
Posted On2018-10-18