Incidental Mutation 'R6817:Esrp1'
ID537368
Institutional Source Beutler Lab
Gene Symbol Esrp1
Ensembl Gene ENSMUSG00000040728
Gene Nameepithelial splicing regulatory protein 1
Synonyms2210008M09Rik, Rbm35a
MMRRC Submission
Accession Numbers

Genbank: NM_194055; MGI: 1917326

Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R6817 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location11331933-11386783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11357552 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 355 (V355A)
Ref Sequence ENSEMBL: ENSMUSP00000121117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043781] [ENSMUST00000108310] [ENSMUST00000108311] [ENSMUST00000108313] [ENSMUST00000147342] [ENSMUST00000155519]
Predicted Effect probably damaging
Transcript: ENSMUST00000043781
AA Change: V520A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037921
Gene: ENSMUSG00000040728
AA Change: V520A

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 552 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108310
AA Change: V520A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103946
Gene: ENSMUSG00000040728
AA Change: V520A

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 552 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108311
AA Change: V520A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103947
Gene: ENSMUSG00000040728
AA Change: V520A

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 556 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108313
AA Change: V520A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103949
Gene: ENSMUSG00000040728
AA Change: V520A

DomainStartEndE-ValueType
RRM 226 298 2.6e-2 SMART
RRM 327 402 1.75e-5 SMART
low complexity region 420 434 N/A INTRINSIC
RRM 446 521 1.03e-2 SMART
low complexity region 542 552 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147342
AA Change: V355A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121117
Gene: ENSMUSG00000040728
AA Change: V355A

DomainStartEndE-ValueType
RRM 61 133 2.6e-2 SMART
RRM 162 237 1.75e-5 SMART
low complexity region 255 269 N/A INTRINSIC
RRM 281 356 1.03e-2 SMART
low complexity region 377 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155519
SMART Domains Protein: ENSMUSP00000119598
Gene: ENSMUSG00000040728

DomainStartEndE-ValueType
RRM 212 284 2.6e-2 SMART
RRM 313 388 1.75e-5 SMART
low complexity region 406 420 N/A INTRINSIC
Blast:RRM 432 472 7e-20 BLAST
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ESPR1 is an epithelial cell-type-specific splicing regulator (Warzecha et al., 2009 [PubMed 19285943]).[supplied by OMIM, Aug 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit hyperactivity and circling with no detectable hearing deficits. Mice homozygous for a null allele exhibit bilateral cleft lip and cleft palate, and die at P0. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Arhgap21 A C 2: 20,880,296 L690R probably benign Het
Asxl3 A G 18: 22,523,580 N1549S probably benign Het
Cast T C 13: 74,699,158 T670A possibly damaging Het
Cd109 A G 9: 78,714,955 D1409G probably benign Het
Cemip A G 7: 83,987,992 F311S probably damaging Het
Cfap43 T A 19: 47,756,085 I1210F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cops5 G A 1: 10,030,604 L256F probably benign Het
Cux1 T C 5: 136,373,173 probably null Het
Dab1 A G 4: 104,679,546 K178E probably damaging Het
Ddc A G 11: 11,824,854 Y346H probably damaging Het
Dlg2 T G 7: 91,965,664 D225E probably benign Het
Dsg1b A T 18: 20,394,405 I198F probably damaging Het
Ect2l T C 10: 18,174,059 H155R probably benign Het
Epha2 A G 4: 141,308,994 H247R probably damaging Het
Fam78b A G 1: 167,078,850 M193V possibly damaging Het
Gdpd4 A G 7: 97,957,830 T4A probably benign Het
Gm17175 T C 14: 51,573,021 N50D possibly damaging Het
Kcnt2 A G 1: 140,246,193 probably benign Het
Lpo T C 11: 87,809,241 N525D probably benign Het
Lrrc41 G A 4: 116,089,305 E406K possibly damaging Het
Lrrc59 G C 11: 94,630,065 D21H probably damaging Het
Mgat4a G A 1: 37,449,123 R472* probably null Het
Mroh7 C T 4: 106,714,115 A14T probably benign Het
Muc5b T C 7: 141,862,913 S3199P probably benign Het
Muc6 T A 7: 141,651,061 Y270F probably damaging Het
Myo18b T A 5: 112,830,238 T1273S probably benign Het
Nos2 A T 11: 78,945,266 E385V possibly damaging Het
Nsl1 T G 1: 191,063,274 probably null Het
Nup93 T C 8: 94,314,682 probably null Het
Olfr1175-ps A T 2: 88,322,763 M314K probably benign Het
Pcna-ps2 T G 19: 9,283,497 M40R probably damaging Het
Pik3r5 A G 11: 68,486,581 E148G probably damaging Het
Pirt A G 11: 66,925,911 E16G probably damaging Het
Pkp4 T C 2: 59,318,600 Y566H probably damaging Het
Psg17 A C 7: 18,814,640 V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rassf7 A G 7: 141,217,447 E191G probably damaging Het
Rnf213 T C 11: 119,462,285 probably null Het
Slc34a2 C T 5: 53,064,028 T272I probably damaging Het
Sos2 T C 12: 69,618,161 E332G probably benign Het
Spdye4c T C 2: 128,596,510 Y263H probably damaging Het
Tmprss11f C T 5: 86,556,934 V42I probably benign Het
Trpv5 T A 6: 41,658,007 N463Y possibly damaging Het
Ush2a A T 1: 188,862,864 Q3831L probably benign Het
Wdr41 C A 13: 94,997,304 probably null Het
Zfand1 A G 3: 10,340,824 C246R probably benign Het
Other mutations in Esrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Esrp1 APN 4 11384374 missense possibly damaging 0.47
IGL02251:Esrp1 APN 4 11361202 missense probably damaging 1.00
IGL02669:Esrp1 APN 4 11386324 missense possibly damaging 0.61
Barley UTSW 4 11365205 missense probably damaging 1.00
triaka UTSW 4 11379300 missense probably benign 0.01
R1109:Esrp1 UTSW 4 11365205 missense probably damaging 1.00
R1531:Esrp1 UTSW 4 11379375 missense probably damaging 0.99
R2189:Esrp1 UTSW 4 11357603 missense probably benign 0.04
R2255:Esrp1 UTSW 4 11365211 missense probably damaging 0.99
R5919:Esrp1 UTSW 4 11344146 missense probably damaging 0.96
R5924:Esrp1 UTSW 4 11361174 missense probably damaging 1.00
R6042:Esrp1 UTSW 4 11357580 missense possibly damaging 0.93
R6749:Esrp1 UTSW 4 11357519 missense probably damaging 1.00
R7392:Esrp1 UTSW 4 11338809 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCCTCAGAAAGAACCAGG -3'
(R):5'- GCTAACCATGTCTTGCACTGTG -3'

Sequencing Primer
(F):5'- TCAGAAAGAACCAGGGGCCC -3'
(R):5'- ATTGTCACTTTGCATGCTTTGTAAG -3'
Posted On2018-10-18