Incidental Mutation 'R6817:Lrrc41'
ID537371
Institutional Source Beutler Lab
Gene Symbol Lrrc41
Ensembl Gene ENSMUSG00000028703
Gene Nameleucine rich repeat containing 41
SynonymsD730026A16Rik, MUF1, D630045E04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R6817 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location116075269-116097043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116089305 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 406 (E406K)
Ref Sequence ENSEMBL: ENSMUSP00000030471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030471]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030471
AA Change: E406K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030471
Gene: ENSMUSG00000028703
AA Change: E406K

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 352 382 N/A INTRINSIC
low complexity region 417 429 N/A INTRINSIC
SCOP:d1yrga_ 449 742 4e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Arhgap21 A C 2: 20,880,296 L690R probably benign Het
Asxl3 A G 18: 22,523,580 N1549S probably benign Het
Cast T C 13: 74,699,158 T670A possibly damaging Het
Cd109 A G 9: 78,714,955 D1409G probably benign Het
Cemip A G 7: 83,987,992 F311S probably damaging Het
Cfap43 T A 19: 47,756,085 I1210F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cops5 G A 1: 10,030,604 L256F probably benign Het
Cux1 T C 5: 136,373,173 probably null Het
Dab1 A G 4: 104,679,546 K178E probably damaging Het
Ddc A G 11: 11,824,854 Y346H probably damaging Het
Dlg2 T G 7: 91,965,664 D225E probably benign Het
Dsg1b A T 18: 20,394,405 I198F probably damaging Het
Ect2l T C 10: 18,174,059 H155R probably benign Het
Epha2 A G 4: 141,308,994 H247R probably damaging Het
Esrp1 A G 4: 11,357,552 V355A probably damaging Het
Fam78b A G 1: 167,078,850 M193V possibly damaging Het
Gdpd4 A G 7: 97,957,830 T4A probably benign Het
Gm17175 T C 14: 51,573,021 N50D possibly damaging Het
Kcnt2 A G 1: 140,246,193 probably benign Het
Lpo T C 11: 87,809,241 N525D probably benign Het
Lrrc59 G C 11: 94,630,065 D21H probably damaging Het
Mgat4a G A 1: 37,449,123 R472* probably null Het
Mroh7 C T 4: 106,714,115 A14T probably benign Het
Muc5b T C 7: 141,862,913 S3199P probably benign Het
Muc6 T A 7: 141,651,061 Y270F probably damaging Het
Myo18b T A 5: 112,830,238 T1273S probably benign Het
Nos2 A T 11: 78,945,266 E385V possibly damaging Het
Nsl1 T G 1: 191,063,274 probably null Het
Nup93 T C 8: 94,314,682 probably null Het
Olfr1175-ps A T 2: 88,322,763 M314K probably benign Het
Pcna-ps2 T G 19: 9,283,497 M40R probably damaging Het
Pik3r5 A G 11: 68,486,581 E148G probably damaging Het
Pirt A G 11: 66,925,911 E16G probably damaging Het
Pkp4 T C 2: 59,318,600 Y566H probably damaging Het
Psg17 A C 7: 18,814,640 V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rassf7 A G 7: 141,217,447 E191G probably damaging Het
Rnf213 T C 11: 119,462,285 probably null Het
Slc34a2 C T 5: 53,064,028 T272I probably damaging Het
Sos2 T C 12: 69,618,161 E332G probably benign Het
Spdye4c T C 2: 128,596,510 Y263H probably damaging Het
Tmprss11f C T 5: 86,556,934 V42I probably benign Het
Trpv5 T A 6: 41,658,007 N463Y possibly damaging Het
Ush2a A T 1: 188,862,864 Q3831L probably benign Het
Wdr41 C A 13: 94,997,304 probably null Het
Zfand1 A G 3: 10,340,824 C246R probably benign Het
Other mutations in Lrrc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Lrrc41 APN 4 116096466 missense probably damaging 0.97
IGL01358:Lrrc41 APN 4 116075587 missense probably benign 0.16
IGL01734:Lrrc41 APN 4 116093134 critical splice donor site probably null
IGL01986:Lrrc41 APN 4 116089322 missense probably benign 0.27
IGL02159:Lrrc41 APN 4 116088486 missense probably benign 0.03
IGL02892:Lrrc41 APN 4 116088835 missense possibly damaging 0.68
IGL03135:Lrrc41 APN 4 116088531 missense probably benign
R1478:Lrrc41 UTSW 4 116095208 nonsense probably null
R1765:Lrrc41 UTSW 4 116089051 missense possibly damaging 0.94
R2233:Lrrc41 UTSW 4 116096385 missense possibly damaging 0.66
R4080:Lrrc41 UTSW 4 116080546 splice site probably null
R4677:Lrrc41 UTSW 4 116095135 missense probably benign
R4833:Lrrc41 UTSW 4 116093177 unclassified probably benign
R4877:Lrrc41 UTSW 4 116079405 missense probably damaging 0.99
R4926:Lrrc41 UTSW 4 116089324 missense possibly damaging 0.46
R6459:Lrrc41 UTSW 4 116088780 missense possibly damaging 0.95
R6834:Lrrc41 UTSW 4 116096529 missense possibly damaging 0.46
R7479:Lrrc41 UTSW 4 116089041 missense probably damaging 0.96
R7512:Lrrc41 UTSW 4 116092994 missense not run
Predicted Primers PCR Primer
(F):5'- AGCCTGGCAATAGGTGGAAC -3'
(R):5'- TGTGAATAGCTCCAAGGTGG -3'

Sequencing Primer
(F):5'- GTGGAACAGACTCTAAGTTGTACCTC -3'
(R):5'- TCCAAGGTGGAAATGCTGC -3'
Posted On2018-10-18