Incidental Mutation 'R6817:Rassf7'
ID537381
Institutional Source Beutler Lab
Gene Symbol Rassf7
Ensembl Gene ENSMUSG00000038618
Gene NameRas association (RalGDS/AF-6) domain family (N-terminal) member 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6817 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141215860-141218658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141217447 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 191 (E191G)
Ref Sequence ENSEMBL: ENSMUSP00000147482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026573] [ENSMUST00000046890] [ENSMUST00000127613] [ENSMUST00000133763] [ENSMUST00000141804] [ENSMUST00000148975] [ENSMUST00000153081] [ENSMUST00000170841] [ENSMUST00000209500] [ENSMUST00000210993]
Predicted Effect probably benign
Transcript: ENSMUST00000026573
SMART Domains Protein: ENSMUSP00000026573
Gene: ENSMUSG00000025500

DomainStartEndE-ValueType
coiled coil region 114 170 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:LTD 375 482 1.3e-13 PFAM
low complexity region 567 578 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000046890
AA Change: E191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038444
Gene: ENSMUSG00000038618
AA Change: E191G

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 215 N/A INTRINSIC
low complexity region 217 244 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127613
Predicted Effect probably damaging
Transcript: ENSMUST00000133763
AA Change: E191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118313
Gene: ENSMUSG00000038618
AA Change: E191G

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 200 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141804
AA Change: E191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115948
Gene: ENSMUSG00000038618
AA Change: E191G

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 215 N/A INTRINSIC
low complexity region 217 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148975
SMART Domains Protein: ENSMUSP00000118078
Gene: ENSMUSG00000038618

DomainStartEndE-ValueType
Blast:RA 6 35 5e-13 BLAST
PDB:2CS4|A 7 35 2e-11 PDB
low complexity region 36 47 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153081
AA Change: E191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123128
Gene: ENSMUSG00000038618
AA Change: E191G

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170841
SMART Domains Protein: ENSMUSP00000130905
Gene: ENSMUSG00000025500

DomainStartEndE-ValueType
coiled coil region 124 180 N/A INTRINSIC
low complexity region 296 308 N/A INTRINSIC
SCOP:d1ifra_ 385 487 1e-22 SMART
low complexity region 577 588 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209500
AA Change: E191G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210993
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Arhgap21 A C 2: 20,880,296 L690R probably benign Het
Asxl3 A G 18: 22,523,580 N1549S probably benign Het
Cast T C 13: 74,699,158 T670A possibly damaging Het
Cd109 A G 9: 78,714,955 D1409G probably benign Het
Cemip A G 7: 83,987,992 F311S probably damaging Het
Cfap43 T A 19: 47,756,085 I1210F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cops5 G A 1: 10,030,604 L256F probably benign Het
Cux1 T C 5: 136,373,173 probably null Het
Dab1 A G 4: 104,679,546 K178E probably damaging Het
Ddc A G 11: 11,824,854 Y346H probably damaging Het
Dlg2 T G 7: 91,965,664 D225E probably benign Het
Dsg1b A T 18: 20,394,405 I198F probably damaging Het
Ect2l T C 10: 18,174,059 H155R probably benign Het
Epha2 A G 4: 141,308,994 H247R probably damaging Het
Esrp1 A G 4: 11,357,552 V355A probably damaging Het
Fam78b A G 1: 167,078,850 M193V possibly damaging Het
Gdpd4 A G 7: 97,957,830 T4A probably benign Het
Gm17175 T C 14: 51,573,021 N50D possibly damaging Het
Kcnt2 A G 1: 140,246,193 probably benign Het
Lpo T C 11: 87,809,241 N525D probably benign Het
Lrrc41 G A 4: 116,089,305 E406K possibly damaging Het
Lrrc59 G C 11: 94,630,065 D21H probably damaging Het
Mgat4a G A 1: 37,449,123 R472* probably null Het
Mroh7 C T 4: 106,714,115 A14T probably benign Het
Muc5b T C 7: 141,862,913 S3199P probably benign Het
Muc6 T A 7: 141,651,061 Y270F probably damaging Het
Myo18b T A 5: 112,830,238 T1273S probably benign Het
Nos2 A T 11: 78,945,266 E385V possibly damaging Het
Nsl1 T G 1: 191,063,274 probably null Het
Nup93 T C 8: 94,314,682 probably null Het
Olfr1175-ps A T 2: 88,322,763 M314K probably benign Het
Pcna-ps2 T G 19: 9,283,497 M40R probably damaging Het
Pik3r5 A G 11: 68,486,581 E148G probably damaging Het
Pirt A G 11: 66,925,911 E16G probably damaging Het
Pkp4 T C 2: 59,318,600 Y566H probably damaging Het
Psg17 A C 7: 18,814,640 V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rnf213 T C 11: 119,462,285 probably null Het
Slc34a2 C T 5: 53,064,028 T272I probably damaging Het
Sos2 T C 12: 69,618,161 E332G probably benign Het
Spdye4c T C 2: 128,596,510 Y263H probably damaging Het
Tmprss11f C T 5: 86,556,934 V42I probably benign Het
Trpv5 T A 6: 41,658,007 N463Y possibly damaging Het
Ush2a A T 1: 188,862,864 Q3831L probably benign Het
Wdr41 C A 13: 94,997,304 probably null Het
Zfand1 A G 3: 10,340,824 C246R probably benign Het
Other mutations in Rassf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02098:Rassf7 APN 7 141218290 missense possibly damaging 0.95
R0883:Rassf7 UTSW 7 141216990 splice site probably benign
R1275:Rassf7 UTSW 7 141217147 missense probably damaging 1.00
R1616:Rassf7 UTSW 7 141216732 missense probably damaging 1.00
R5546:Rassf7 UTSW 7 141217060 unclassified probably null
R5597:Rassf7 UTSW 7 141217111 missense probably damaging 1.00
R5663:Rassf7 UTSW 7 141217090 missense probably damaging 1.00
R6250:Rassf7 UTSW 7 141217243 missense probably damaging 0.98
R6806:Rassf7 UTSW 7 141216809 missense probably damaging 1.00
R6962:Rassf7 UTSW 7 141217590 missense possibly damaging 0.86
R7054:Rassf7 UTSW 7 141217643 missense probably benign 0.01
R7562:Rassf7 UTSW 7 141217188 nonsense probably null
X0026:Rassf7 UTSW 7 141218132 nonsense probably null
Z1088:Rassf7 UTSW 7 141217145 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGACCTTCAACCTTAGATGTCC -3'
(R):5'- ATCTCCAGACTATGCCGCTC -3'

Sequencing Primer
(F):5'- ACCTTAGATGTCCCAAGCTGG -3'
(R):5'- AGACTATGCCGCTCCTGGG -3'
Posted On2018-10-18