Incidental Mutation 'R6817:Rnf213'
ID 537394
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Name ring finger protein 213
Synonyms D11Ertd759e
MMRRC Submission 044929-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6817 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 119283926-119378244 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 119353111 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000093902
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000131035
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Meta Mutation Damage Score 0.9490 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 107,969,878 (GRCm39) H186Y probably damaging Het
Arhgap21 A C 2: 20,885,107 (GRCm39) L690R probably benign Het
Asxl3 A G 18: 22,656,637 (GRCm39) N1549S probably benign Het
Cast T C 13: 74,847,277 (GRCm39) T670A possibly damaging Het
Cd109 A G 9: 78,622,237 (GRCm39) D1409G probably benign Het
Cemip A G 7: 83,637,200 (GRCm39) F311S probably damaging Het
Cfap43 T A 19: 47,744,524 (GRCm39) I1210F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Cops5 G A 1: 10,100,829 (GRCm39) L256F probably benign Het
Cux1 T C 5: 136,402,027 (GRCm39) probably null Het
Dab1 A G 4: 104,536,743 (GRCm39) K178E probably damaging Het
Ddc A G 11: 11,774,854 (GRCm39) Y346H probably damaging Het
Dlg2 T G 7: 91,614,872 (GRCm39) D225E probably benign Het
Dsg1b A T 18: 20,527,462 (GRCm39) I198F probably damaging Het
Ect2l T C 10: 18,049,807 (GRCm39) H155R probably benign Het
Epha2 A G 4: 141,036,305 (GRCm39) H247R probably damaging Het
Esrp1 A G 4: 11,357,552 (GRCm39) V355A probably damaging Het
Fam78b A G 1: 166,906,419 (GRCm39) M193V possibly damaging Het
Gdpd4 A G 7: 97,607,037 (GRCm39) T4A probably benign Het
Gm17175 T C 14: 51,810,478 (GRCm39) N50D possibly damaging Het
Kcnt2 A G 1: 140,173,931 (GRCm39) probably benign Het
Lpo T C 11: 87,700,067 (GRCm39) N525D probably benign Het
Lrrc41 G A 4: 115,946,502 (GRCm39) E406K possibly damaging Het
Lrrc59 G C 11: 94,520,891 (GRCm39) D21H probably damaging Het
Mgat4a G A 1: 37,488,204 (GRCm39) R472* probably null Het
Mroh7 C T 4: 106,571,312 (GRCm39) A14T probably benign Het
Muc5b T C 7: 141,416,650 (GRCm39) S3199P probably benign Het
Muc6 T A 7: 141,237,326 (GRCm39) Y270F probably damaging Het
Myo18b T A 5: 112,978,104 (GRCm39) T1273S probably benign Het
Nos2 A T 11: 78,836,092 (GRCm39) E385V possibly damaging Het
Nsl1 T G 1: 190,795,471 (GRCm39) probably null Het
Nup93 T C 8: 95,041,310 (GRCm39) probably null Het
Or5d45 A T 2: 88,153,107 (GRCm39) M314K probably benign Het
Pcna-ps2 T G 19: 9,260,861 (GRCm39) M40R probably damaging Het
Pik3r5 A G 11: 68,377,407 (GRCm39) E148G probably damaging Het
Pirt A G 11: 66,816,737 (GRCm39) E16G probably damaging Het
Pkp4 T C 2: 59,148,944 (GRCm39) Y566H probably damaging Het
Psg17 A C 7: 18,548,565 (GRCm39) V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,119,582 (GRCm39) probably benign Het
Rassf7 A G 7: 140,797,360 (GRCm39) E191G probably damaging Het
Slc34a2 C T 5: 53,221,370 (GRCm39) T272I probably damaging Het
Sos2 T C 12: 69,664,935 (GRCm39) E332G probably benign Het
Spdye4c T C 2: 128,438,430 (GRCm39) Y263H probably damaging Het
Tmprss11f C T 5: 86,704,793 (GRCm39) V42I probably benign Het
Trpv5 T A 6: 41,634,941 (GRCm39) N463Y possibly damaging Het
Ush2a A T 1: 188,595,061 (GRCm39) Q3831L probably benign Het
Wdr41 C A 13: 95,133,812 (GRCm39) probably null Het
Zfand1 A G 3: 10,405,884 (GRCm39) C246R probably benign Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119,340,169 (GRCm39) missense probably benign 0.00
IGL00961:Rnf213 APN 11 119,331,669 (GRCm39) missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119,338,063 (GRCm39) missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119,373,944 (GRCm39) missense probably benign 0.25
IGL01403:Rnf213 APN 11 119,334,126 (GRCm39) missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119,340,702 (GRCm39) critical splice donor site probably null
IGL01765:Rnf213 APN 11 119,327,178 (GRCm39) missense probably benign 0.00
IGL01803:Rnf213 APN 11 119,332,133 (GRCm39) missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119,333,092 (GRCm39) missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119,333,841 (GRCm39) missense probably benign 0.05
IGL01944:Rnf213 APN 11 119,307,283 (GRCm39) missense probably benign 0.01
IGL01982:Rnf213 APN 11 119,334,094 (GRCm39) missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119,309,135 (GRCm39) splice site probably benign
IGL02084:Rnf213 APN 11 119,336,499 (GRCm39) missense probably benign 0.04
IGL02253:Rnf213 APN 11 119,331,476 (GRCm39) missense probably benign 0.03
IGL02254:Rnf213 APN 11 119,371,733 (GRCm39) missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119,354,162 (GRCm39) missense probably benign 0.01
IGL02531:Rnf213 APN 11 119,327,628 (GRCm39) missense probably benign
IGL02588:Rnf213 APN 11 119,307,362 (GRCm39) missense probably benign 0.30
IGL02615:Rnf213 APN 11 119,331,615 (GRCm39) missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119,325,892 (GRCm39) missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119,318,336 (GRCm39) missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119,370,767 (GRCm39) missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119,336,452 (GRCm39) splice site probably benign
IGL03057:Rnf213 APN 11 119,331,913 (GRCm39) missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119,355,833 (GRCm39) missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119,364,998 (GRCm39) missense probably benign 0.03
IGL03339:Rnf213 APN 11 119,333,830 (GRCm39) missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119,312,294 (GRCm39) missense probably benign 0.34
attrition UTSW 11 119,321,147 (GRCm39) missense possibly damaging 0.77
defame UTSW 11 119,321,107 (GRCm39) nonsense probably null
Derogate UTSW 11 119,361,036 (GRCm39) missense probably damaging 1.00
dinky UTSW 11 119,307,284 (GRCm39) missense probably damaging 0.99
G1funyon_rnf213_024 UTSW 11 119,325,568 (GRCm39) missense
Impugn UTSW 11 119,327,649 (GRCm39) nonsense probably null
R4332_Rnf213_642 UTSW 11 119,327,502 (GRCm39) missense probably damaging 1.00
B6584:Rnf213 UTSW 11 119,316,895 (GRCm39) missense probably damaging 0.97
G1Funyon:Rnf213 UTSW 11 119,325,568 (GRCm39) missense
PIT4585001:Rnf213 UTSW 11 119,349,218 (GRCm39) missense
R0008:Rnf213 UTSW 11 119,355,878 (GRCm39) missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119,332,432 (GRCm39) missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119,293,401 (GRCm39) missense probably benign 0.41
R0114:Rnf213 UTSW 11 119,305,413 (GRCm39) missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R0131:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R0132:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R0138:Rnf213 UTSW 11 119,307,322 (GRCm39) missense probably benign 0.05
R0144:Rnf213 UTSW 11 119,370,426 (GRCm39) nonsense probably null
R0184:Rnf213 UTSW 11 119,305,347 (GRCm39) missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119,328,931 (GRCm39) nonsense probably null
R0365:Rnf213 UTSW 11 119,316,937 (GRCm39) missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119,305,295 (GRCm39) missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119,338,083 (GRCm39) missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119,316,838 (GRCm39) missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119,333,946 (GRCm39) missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119,355,908 (GRCm39) missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119,334,106 (GRCm39) missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119,322,543 (GRCm39) missense probably benign 0.03
R0638:Rnf213 UTSW 11 119,361,036 (GRCm39) missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119,332,660 (GRCm39) missense probably benign 0.28
R0715:Rnf213 UTSW 11 119,331,976 (GRCm39) missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119,331,894 (GRCm39) missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119,364,306 (GRCm39) missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119,313,921 (GRCm39) critical splice donor site probably null
R0890:Rnf213 UTSW 11 119,321,312 (GRCm39) missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119,305,396 (GRCm39) missense probably benign 0.00
R0940:Rnf213 UTSW 11 119,307,389 (GRCm39) missense probably benign 0.10
R0959:Rnf213 UTSW 11 119,343,407 (GRCm39) missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119,376,824 (GRCm39) splice site probably benign
R1104:Rnf213 UTSW 11 119,368,055 (GRCm39) missense probably benign 0.29
R1141:Rnf213 UTSW 11 119,326,809 (GRCm39) missense probably benign 0.02
R1219:Rnf213 UTSW 11 119,327,003 (GRCm39) missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119,326,831 (GRCm39) missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119,333,226 (GRCm39) missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119,328,576 (GRCm39) missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119,371,715 (GRCm39) missense probably benign 0.05
R1523:Rnf213 UTSW 11 119,332,714 (GRCm39) missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119,333,533 (GRCm39) missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119,332,665 (GRCm39) missense probably benign 0.06
R1563:Rnf213 UTSW 11 119,305,352 (GRCm39) missense probably benign 0.13
R1572:Rnf213 UTSW 11 119,327,437 (GRCm39) missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119,354,171 (GRCm39) missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119,333,405 (GRCm39) missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119,328,498 (GRCm39) missense probably benign 0.01
R1789:Rnf213 UTSW 11 119,331,047 (GRCm39) missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119,332,009 (GRCm39) missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119,340,955 (GRCm39) missense probably benign 0.08
R1893:Rnf213 UTSW 11 119,307,274 (GRCm39) missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119,322,511 (GRCm39) missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119,371,721 (GRCm39) missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119,331,933 (GRCm39) missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119,326,848 (GRCm39) missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119,352,744 (GRCm39) missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119,358,128 (GRCm39) nonsense probably null
R2109:Rnf213 UTSW 11 119,333,489 (GRCm39) nonsense probably null
R2115:Rnf213 UTSW 11 119,318,839 (GRCm39) missense probably benign 0.00
R2126:Rnf213 UTSW 11 119,341,027 (GRCm39) missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119,334,516 (GRCm39) missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119,306,019 (GRCm39) missense probably benign 0.03
R2168:Rnf213 UTSW 11 119,305,896 (GRCm39) missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R2199:Rnf213 UTSW 11 119,350,835 (GRCm39) missense probably benign 0.01
R2220:Rnf213 UTSW 11 119,327,254 (GRCm39) missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119,305,430 (GRCm39) missense probably benign 0.02
R2400:Rnf213 UTSW 11 119,334,021 (GRCm39) missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119,350,764 (GRCm39) splice site probably null
R2698:Rnf213 UTSW 11 119,300,970 (GRCm39) missense probably benign 0.26
R3151:Rnf213 UTSW 11 119,359,718 (GRCm39) missense probably benign 0.03
R3607:Rnf213 UTSW 11 119,332,802 (GRCm39) nonsense probably null
R3808:Rnf213 UTSW 11 119,370,384 (GRCm39) missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119,371,765 (GRCm39) splice site probably benign
R3856:Rnf213 UTSW 11 119,371,765 (GRCm39) splice site probably benign
R3973:Rnf213 UTSW 11 119,359,879 (GRCm39) missense
R4014:Rnf213 UTSW 11 119,336,555 (GRCm39) nonsense probably null
R4049:Rnf213 UTSW 11 119,373,274 (GRCm39) missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119,373,832 (GRCm39) missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119,300,308 (GRCm39) missense probably benign 0.27
R4167:Rnf213 UTSW 11 119,332,069 (GRCm39) missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119,327,649 (GRCm39) nonsense probably null
R4332:Rnf213 UTSW 11 119,327,502 (GRCm39) missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119,374,790 (GRCm39) missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119,370,496 (GRCm39) critical splice donor site probably null
R4609:Rnf213 UTSW 11 119,328,521 (GRCm39) missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119,331,951 (GRCm39) missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119,331,175 (GRCm39) missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119,310,893 (GRCm39) missense probably benign 0.38
R4751:Rnf213 UTSW 11 119,336,571 (GRCm39) missense probably benign 0.12
R4828:Rnf213 UTSW 11 119,307,455 (GRCm39) missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119,333,589 (GRCm39) missense probably benign 0.00
R4894:Rnf213 UTSW 11 119,372,066 (GRCm39) missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119,318,983 (GRCm39) missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119,327,590 (GRCm39) missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119,301,633 (GRCm39) missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119,349,692 (GRCm39) missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119,331,642 (GRCm39) missense probably benign 0.00
R5406:Rnf213 UTSW 11 119,331,634 (GRCm39) missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119,299,846 (GRCm39) missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119,305,902 (GRCm39) missense probably benign 0.44
R5520:Rnf213 UTSW 11 119,324,325 (GRCm39) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,327,731 (GRCm39) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,327,455 (GRCm39) missense probably benign 0.04
R5669:Rnf213 UTSW 11 119,349,611 (GRCm39) missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119,325,512 (GRCm39) critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119,374,720 (GRCm39) missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119,307,284 (GRCm39) missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119,327,121 (GRCm39) missense probably benign
R5861:Rnf213 UTSW 11 119,364,203 (GRCm39) missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119,312,195 (GRCm39) missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119,333,905 (GRCm39) missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119,376,836 (GRCm39) missense probably benign 0.00
R6043:Rnf213 UTSW 11 119,332,927 (GRCm39) missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119,307,385 (GRCm39) missense probably benign 0.14
R6123:Rnf213 UTSW 11 119,302,339 (GRCm39) missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119,302,296 (GRCm39) missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119,332,854 (GRCm39) missense probably benign 0.02
R6146:Rnf213 UTSW 11 119,326,825 (GRCm39) missense probably benign 0.41
R6163:Rnf213 UTSW 11 119,349,254 (GRCm39) missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119,305,374 (GRCm39) missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119,354,192 (GRCm39) missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119,367,904 (GRCm39) missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119,350,792 (GRCm39) missense probably benign 0.03
R6468:Rnf213 UTSW 11 119,343,513 (GRCm39) missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119,327,106 (GRCm39) missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119,370,746 (GRCm39) missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119,321,147 (GRCm39) missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119,333,097 (GRCm39) missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119,333,062 (GRCm39) missense probably damaging 0.99
R6820:Rnf213 UTSW 11 119,339,664 (GRCm39) missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119,340,692 (GRCm39) missense probably benign 0.26
R6934:Rnf213 UTSW 11 119,310,893 (GRCm39) missense probably benign 0.38
R7026:Rnf213 UTSW 11 119,370,481 (GRCm39) missense possibly damaging 0.58
R7094:Rnf213 UTSW 11 119,328,430 (GRCm39) splice site probably null
R7170:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7185:Rnf213 UTSW 11 119,315,024 (GRCm39) missense
R7239:Rnf213 UTSW 11 119,349,614 (GRCm39) missense
R7258:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7259:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7260:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7273:Rnf213 UTSW 11 119,322,582 (GRCm39) splice site probably null
R7282:Rnf213 UTSW 11 119,328,818 (GRCm39) missense
R7311:Rnf213 UTSW 11 119,307,373 (GRCm39) missense
R7352:Rnf213 UTSW 11 119,334,405 (GRCm39) missense
R7369:Rnf213 UTSW 11 119,321,294 (GRCm39) missense
R7410:Rnf213 UTSW 11 119,325,877 (GRCm39) missense
R7448:Rnf213 UTSW 11 119,372,117 (GRCm39) missense
R7561:Rnf213 UTSW 11 119,332,545 (GRCm39) missense
R7573:Rnf213 UTSW 11 119,349,310 (GRCm39) missense
R7615:Rnf213 UTSW 11 119,358,123 (GRCm39) missense
R7680:Rnf213 UTSW 11 119,370,382 (GRCm39) missense
R7739:Rnf213 UTSW 11 119,301,687 (GRCm39) missense
R7789:Rnf213 UTSW 11 119,361,045 (GRCm39) splice site probably null
R7806:Rnf213 UTSW 11 119,302,371 (GRCm39) missense
R8031:Rnf213 UTSW 11 119,321,107 (GRCm39) nonsense probably null
R8042:Rnf213 UTSW 11 119,332,480 (GRCm39) missense
R8053:Rnf213 UTSW 11 119,293,473 (GRCm39) missense
R8284:Rnf213 UTSW 11 119,318,909 (GRCm39) missense
R8301:Rnf213 UTSW 11 119,325,568 (GRCm39) missense
R8325:Rnf213 UTSW 11 119,321,271 (GRCm39) missense
R8332:Rnf213 UTSW 11 119,374,524 (GRCm39) missense
R8443:Rnf213 UTSW 11 119,340,149 (GRCm39) missense
R8518:Rnf213 UTSW 11 119,353,043 (GRCm39) missense
R8531:Rnf213 UTSW 11 119,365,031 (GRCm39) missense probably benign 0.02
R8670:Rnf213 UTSW 11 119,349,563 (GRCm39) missense
R8675:Rnf213 UTSW 11 119,346,984 (GRCm39) missense
R8690:Rnf213 UTSW 11 119,332,038 (GRCm39) missense
R8690:Rnf213 UTSW 11 119,308,955 (GRCm39) missense
R8714:Rnf213 UTSW 11 119,359,720 (GRCm39) missense
R8802:Rnf213 UTSW 11 119,352,928 (GRCm39) missense
R8861:Rnf213 UTSW 11 119,333,062 (GRCm39) missense
R8886:Rnf213 UTSW 11 119,364,264 (GRCm39) missense
R8893:Rnf213 UTSW 11 119,333,868 (GRCm39) missense
R8937:Rnf213 UTSW 11 119,321,100 (GRCm39) missense possibly damaging 0.94
R8941:Rnf213 UTSW 11 119,305,250 (GRCm39) missense probably damaging 1.00
R8973:Rnf213 UTSW 11 119,352,756 (GRCm39) missense
R8983:Rnf213 UTSW 11 119,321,175 (GRCm39) missense
R9043:Rnf213 UTSW 11 119,349,739 (GRCm39) missense
R9081:Rnf213 UTSW 11 119,357,062 (GRCm39) missense
R9132:Rnf213 UTSW 11 119,374,742 (GRCm39) missense
R9135:Rnf213 UTSW 11 119,299,573 (GRCm39) missense
R9146:Rnf213 UTSW 11 119,334,499 (GRCm39) missense
R9156:Rnf213 UTSW 11 119,331,574 (GRCm39) missense
R9183:Rnf213 UTSW 11 119,318,448 (GRCm39) missense
R9234:Rnf213 UTSW 11 119,340,943 (GRCm39) missense
R9275:Rnf213 UTSW 11 119,326,768 (GRCm39) missense
R9278:Rnf213 UTSW 11 119,326,768 (GRCm39) missense
R9296:Rnf213 UTSW 11 119,334,621 (GRCm39) splice site probably benign
R9350:Rnf213 UTSW 11 119,332,975 (GRCm39) missense
R9366:Rnf213 UTSW 11 119,327,057 (GRCm39) missense
R9413:Rnf213 UTSW 11 119,357,059 (GRCm39) missense
R9444:Rnf213 UTSW 11 119,325,623 (GRCm39) missense
R9464:Rnf213 UTSW 11 119,354,406 (GRCm39) missense
R9605:Rnf213 UTSW 11 119,359,879 (GRCm39) missense
R9649:Rnf213 UTSW 11 119,370,457 (GRCm39) missense
R9651:Rnf213 UTSW 11 119,331,238 (GRCm39) missense
R9664:Rnf213 UTSW 11 119,332,794 (GRCm39) missense
R9696:Rnf213 UTSW 11 119,359,806 (GRCm39) missense
R9710:Rnf213 UTSW 11 119,331,831 (GRCm39) missense
R9797:Rnf213 UTSW 11 119,333,365 (GRCm39) missense
S24628:Rnf213 UTSW 11 119,305,295 (GRCm39) missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119,332,650 (GRCm39) missense probably benign 0.14
X0062:Rnf213 UTSW 11 119,364,339 (GRCm39) missense probably benign 0.05
X0064:Rnf213 UTSW 11 119,331,289 (GRCm39) missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119,368,080 (GRCm39) missense possibly damaging 0.69
Z1176:Rnf213 UTSW 11 119,373,824 (GRCm39) missense
Z1176:Rnf213 UTSW 11 119,332,236 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CCATGTTTCATCTGCCATGGAG -3'
(R):5'- CCAAGGACTTTGTGACTTTCTAGC -3'

Sequencing Primer
(F):5'- TCATCTGCCATGGAGATGCG -3'
(R):5'- AGGACTTTGTGACTTTCTAGCTTATC -3'
Posted On 2018-10-18