Incidental Mutation 'R6817:Cast'
ID537396
Institutional Source Beutler Lab
Gene Symbol Cast
Ensembl Gene ENSMUSG00000021585
Gene Namecalpastatin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6817 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location74692368-74808810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74699158 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 670 (T670A)
Ref Sequence ENSEMBL: ENSMUSP00000152118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065629] [ENSMUST00000220738] [ENSMUST00000222588] [ENSMUST00000223033] [ENSMUST00000223126] [ENSMUST00000223206] [ENSMUST00000223309]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065629
AA Change: T720A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065275
Gene: ENSMUSG00000021585
AA Change: T720A

DomainStartEndE-ValueType
Pfam:Calpain_inhib 15 272 8.1e-9 PFAM
Pfam:Calpain_inhib 279 404 2.7e-36 PFAM
Pfam:Calpain_inhib 415 544 3.6e-38 PFAM
Pfam:Calpain_inhib 556 684 4.5e-36 PFAM
low complexity region 708 744 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000220738
AA Change: T411A
Predicted Effect probably benign
Transcript: ENSMUST00000222588
AA Change: T652A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223033
AA Change: T670A

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000223126
AA Change: T640A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223206
AA Change: T754A

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect unknown
Transcript: ENSMUST00000223309
AA Change: T397A
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes an inhibitor of the calcium-dependent cysteine protease, calpain. This protein plays roles in multiple processes, including apoptosis, cell cycle regulation, and membrane fusion. Multiple protein isoforms exist which contain unique N-terminal domains, and multiple inhibitory domains that share homology with each other. Some isoforms may be tissue-specific. Two different pseudogenes of this gene are found on chromosome 19. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knockout allele exhibit augmented DNA fragmentation in CA1 pyramidal neurons following excitotoxic kainate treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Arhgap21 A C 2: 20,880,296 L690R probably benign Het
Asxl3 A G 18: 22,523,580 N1549S probably benign Het
Cd109 A G 9: 78,714,955 D1409G probably benign Het
Cemip A G 7: 83,987,992 F311S probably damaging Het
Cfap43 T A 19: 47,756,085 I1210F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cops5 G A 1: 10,030,604 L256F probably benign Het
Cux1 T C 5: 136,373,173 probably null Het
Dab1 A G 4: 104,679,546 K178E probably damaging Het
Ddc A G 11: 11,824,854 Y346H probably damaging Het
Dlg2 T G 7: 91,965,664 D225E probably benign Het
Dsg1b A T 18: 20,394,405 I198F probably damaging Het
Ect2l T C 10: 18,174,059 H155R probably benign Het
Epha2 A G 4: 141,308,994 H247R probably damaging Het
Esrp1 A G 4: 11,357,552 V355A probably damaging Het
Fam78b A G 1: 167,078,850 M193V possibly damaging Het
Gdpd4 A G 7: 97,957,830 T4A probably benign Het
Gm17175 T C 14: 51,573,021 N50D possibly damaging Het
Kcnt2 A G 1: 140,246,193 probably benign Het
Lpo T C 11: 87,809,241 N525D probably benign Het
Lrrc41 G A 4: 116,089,305 E406K possibly damaging Het
Lrrc59 G C 11: 94,630,065 D21H probably damaging Het
Mgat4a G A 1: 37,449,123 R472* probably null Het
Mroh7 C T 4: 106,714,115 A14T probably benign Het
Muc5b T C 7: 141,862,913 S3199P probably benign Het
Muc6 T A 7: 141,651,061 Y270F probably damaging Het
Myo18b T A 5: 112,830,238 T1273S probably benign Het
Nos2 A T 11: 78,945,266 E385V possibly damaging Het
Nsl1 T G 1: 191,063,274 probably null Het
Nup93 T C 8: 94,314,682 probably null Het
Olfr1175-ps A T 2: 88,322,763 M314K probably benign Het
Pcna-ps2 T G 19: 9,283,497 M40R probably damaging Het
Pik3r5 A G 11: 68,486,581 E148G probably damaging Het
Pirt A G 11: 66,925,911 E16G probably damaging Het
Pkp4 T C 2: 59,318,600 Y566H probably damaging Het
Psg17 A C 7: 18,814,640 V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rassf7 A G 7: 141,217,447 E191G probably damaging Het
Rnf213 T C 11: 119,462,285 probably null Het
Slc34a2 C T 5: 53,064,028 T272I probably damaging Het
Sos2 T C 12: 69,618,161 E332G probably benign Het
Spdye4c T C 2: 128,596,510 Y263H probably damaging Het
Tmprss11f C T 5: 86,556,934 V42I probably benign Het
Trpv5 T A 6: 41,658,007 N463Y possibly damaging Het
Ush2a A T 1: 188,862,864 Q3831L probably benign Het
Wdr41 C A 13: 94,997,304 probably null Het
Zfand1 A G 3: 10,340,824 C246R probably benign Het
Other mutations in Cast
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cast APN 13 74736974 missense probably damaging 1.00
IGL01363:Cast APN 13 74704192 missense possibly damaging 0.95
IGL01404:Cast APN 13 74738287 nonsense probably null
IGL01893:Cast APN 13 74727289 nonsense probably null
IGL02139:Cast APN 13 74728365 missense possibly damaging 0.80
IGL02444:Cast APN 13 74739853 missense probably damaging 1.00
IGL02927:Cast APN 13 74736994 missense probably damaging 1.00
IGL02941:Cast APN 13 74700687 missense probably damaging 1.00
IGL02799:Cast UTSW 13 74736752 missense probably damaging 1.00
R0583:Cast UTSW 13 74713678 missense probably damaging 0.99
R2031:Cast UTSW 13 74798652 splice site probably null
R2256:Cast UTSW 13 74739905 missense probably damaging 0.99
R2509:Cast UTSW 13 74737616 missense probably benign 0.19
R3923:Cast UTSW 13 74728413 missense probably damaging 1.00
R4116:Cast UTSW 13 74724837 missense probably damaging 1.00
R4649:Cast UTSW 13 74746014 missense probably benign 0.25
R4651:Cast UTSW 13 74746014 missense probably benign 0.25
R4652:Cast UTSW 13 74746014 missense probably benign 0.25
R4653:Cast UTSW 13 74746014 missense probably benign 0.25
R4714:Cast UTSW 13 74798715 missense probably damaging 1.00
R4751:Cast UTSW 13 74746047 missense probably damaging 1.00
R4758:Cast UTSW 13 74739880 missense possibly damaging 0.90
R4974:Cast UTSW 13 74807823 missense probably benign
R5040:Cast UTSW 13 74724813 missense probably damaging 1.00
R5397:Cast UTSW 13 74720937 missense possibly damaging 0.83
R5556:Cast UTSW 13 74695889 critical splice donor site probably null
R5863:Cast UTSW 13 74736756 missense probably damaging 1.00
R6030:Cast UTSW 13 74695937 missense possibly damaging 0.83
R6030:Cast UTSW 13 74695937 missense possibly damaging 0.83
R6349:Cast UTSW 13 74721195 missense probably damaging 1.00
R6829:Cast UTSW 13 74728344 missense possibly damaging 0.50
R6848:Cast UTSW 13 74695933 missense possibly damaging 0.66
R7275:Cast UTSW 13 74727334 missense probably benign 0.00
R7401:Cast UTSW 13 74808458 missense unknown
X0011:Cast UTSW 13 74725456 missense probably damaging 1.00
X0066:Cast UTSW 13 74736979 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACTTGAATTATGTTAAGGAC -3'
(R):5'- TTTGTAGCCTTTTAAATGTCCTGCTT -3'

Sequencing Primer
(F):5'- AAACCCAGATCCGGGTTAGCTTG -3'
(R):5'- GATCTAGGCTGCTAGGAA -3'
Posted On2018-10-18