Incidental Mutation 'R6817:Wdr41'
ID537397
Institutional Source Beutler Lab
Gene Symbol Wdr41
Ensembl Gene ENSMUSG00000042015
Gene NameWD repeat domain 41
SynonymsB830029I03Rik, MSTP048
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6817 (G1)
Quality Score126.008
Status Validated
Chromosome13
Chromosomal Location94976344-95023314 bp(+) (GRCm38)
Type of Mutationintron (116 bp from exon)
DNA Base Change (assembly) C to A at 94997304 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056512] [ENSMUST00000159647] [ENSMUST00000160115] [ENSMUST00000160801] [ENSMUST00000167155] [ENSMUST00000222995]
Predicted Effect probably null
Transcript: ENSMUST00000056512
SMART Domains Protein: ENSMUSP00000055145
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
WD40 211 249 2.86e0 SMART
WD40 308 350 7.92e-3 SMART
WD40 394 432 1.67e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159647
SMART Domains Protein: ENSMUSP00000138501
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 9e-6 BLAST
internal_repeat_1 233 260 6.23e-8 PROSPERO
internal_repeat_1 269 309 6.23e-8 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000160115
SMART Domains Protein: ENSMUSP00000138543
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 1e-5 BLAST
internal_repeat_2 224 281 1.46e-11 PROSPERO
internal_repeat_1 233 315 2.35e-20 PROSPERO
internal_repeat_2 306 365 1.46e-11 PROSPERO
internal_repeat_1 353 435 2.35e-20 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000160801
SMART Domains Protein: ENSMUSP00000124033
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
WD40 211 249 2.86e0 SMART
WD40 308 350 7.92e-3 SMART
WD40 394 432 1.67e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167155
SMART Domains Protein: ENSMUSP00000129595
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 9e-6 BLAST
internal_repeat_1 233 260 6.23e-8 PROSPERO
internal_repeat_1 269 309 6.23e-8 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000222995
Meta Mutation Damage Score 0.6568 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes a protein of unknown function, but which contains a WD40 domain consisting of six WD40 repeats. The WD40 domain is one of the most abundant protein domains in eukaryotes, and is found in proteins with widely varying cellular functions. However, proteins with this domain often provide a rigid scaffold for protein-protein interactions. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Arhgap21 A C 2: 20,880,296 L690R probably benign Het
Asxl3 A G 18: 22,523,580 N1549S probably benign Het
Cast T C 13: 74,699,158 T670A possibly damaging Het
Cd109 A G 9: 78,714,955 D1409G probably benign Het
Cemip A G 7: 83,987,992 F311S probably damaging Het
Cfap43 T A 19: 47,756,085 I1210F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cops5 G A 1: 10,030,604 L256F probably benign Het
Cux1 T C 5: 136,373,173 probably null Het
Dab1 A G 4: 104,679,546 K178E probably damaging Het
Ddc A G 11: 11,824,854 Y346H probably damaging Het
Dlg2 T G 7: 91,965,664 D225E probably benign Het
Dsg1b A T 18: 20,394,405 I198F probably damaging Het
Ect2l T C 10: 18,174,059 H155R probably benign Het
Epha2 A G 4: 141,308,994 H247R probably damaging Het
Esrp1 A G 4: 11,357,552 V355A probably damaging Het
Fam78b A G 1: 167,078,850 M193V possibly damaging Het
Gdpd4 A G 7: 97,957,830 T4A probably benign Het
Gm17175 T C 14: 51,573,021 N50D possibly damaging Het
Kcnt2 A G 1: 140,246,193 probably benign Het
Lpo T C 11: 87,809,241 N525D probably benign Het
Lrrc41 G A 4: 116,089,305 E406K possibly damaging Het
Lrrc59 G C 11: 94,630,065 D21H probably damaging Het
Mgat4a G A 1: 37,449,123 R472* probably null Het
Mroh7 C T 4: 106,714,115 A14T probably benign Het
Muc5b T C 7: 141,862,913 S3199P probably benign Het
Muc6 T A 7: 141,651,061 Y270F probably damaging Het
Myo18b T A 5: 112,830,238 T1273S probably benign Het
Nos2 A T 11: 78,945,266 E385V possibly damaging Het
Nsl1 T G 1: 191,063,274 probably null Het
Nup93 T C 8: 94,314,682 probably null Het
Olfr1175-ps A T 2: 88,322,763 M314K probably benign Het
Pcna-ps2 T G 19: 9,283,497 M40R probably damaging Het
Pik3r5 A G 11: 68,486,581 E148G probably damaging Het
Pirt A G 11: 66,925,911 E16G probably damaging Het
Pkp4 T C 2: 59,318,600 Y566H probably damaging Het
Psg17 A C 7: 18,814,640 V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rassf7 A G 7: 141,217,447 E191G probably damaging Het
Rnf213 T C 11: 119,462,285 probably null Het
Slc34a2 C T 5: 53,064,028 T272I probably damaging Het
Sos2 T C 12: 69,618,161 E332G probably benign Het
Spdye4c T C 2: 128,596,510 Y263H probably damaging Het
Tmprss11f C T 5: 86,556,934 V42I probably benign Het
Trpv5 T A 6: 41,658,007 N463Y possibly damaging Het
Ush2a A T 1: 188,862,864 Q3831L probably benign Het
Zfand1 A G 3: 10,340,824 C246R probably benign Het
Other mutations in Wdr41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Wdr41 APN 13 95017456 unclassified probably benign
IGL02813:Wdr41 APN 13 94995245 splice site probably null
gogi UTSW 13 95015217 critical splice donor site probably null
metallica UTSW 13 95015174 nonsense probably null
R0047:Wdr41 UTSW 13 95010287 missense probably damaging 1.00
R0110:Wdr41 UTSW 13 95018111 unclassified probably benign
R0243:Wdr41 UTSW 13 95017406 missense probably damaging 1.00
R0537:Wdr41 UTSW 13 94995305 splice site probably benign
R2025:Wdr41 UTSW 13 95018948 missense probably damaging 1.00
R2116:Wdr41 UTSW 13 95015029 critical splice acceptor site probably null
R3953:Wdr41 UTSW 13 94997063 missense probably damaging 1.00
R4886:Wdr41 UTSW 13 95015174 nonsense probably null
R5055:Wdr41 UTSW 13 95015217 critical splice donor site probably null
R5266:Wdr41 UTSW 13 94995251 missense probably damaging 1.00
R5276:Wdr41 UTSW 13 95017450 critical splice donor site probably null
R5738:Wdr41 UTSW 13 94978488 missense possibly damaging 0.55
R5957:Wdr41 UTSW 13 94997187 critical splice donor site probably null
R6682:Wdr41 UTSW 13 95013131 missense probably damaging 1.00
R6815:Wdr41 UTSW 13 95018174 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAACTCAGAGGACACACTC -3'
(R):5'- TCATACACGAGGGCGAAATTG -3'

Sequencing Primer
(F):5'- CTCAGAAGATAACGGCTGTCATTGC -3'
(R):5'- GGGCGAAATTGATTATTTTCCAGTCC -3'
Posted On2018-10-18