Incidental Mutation 'R6817:Dsg1b'
ID537399
Institutional Source Beutler Lab
Gene Symbol Dsg1b
Ensembl Gene ENSMUSG00000061928
Gene Namedesmoglein 1 beta
SynonymsDsg5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6817 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20376729-20410196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20394405 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 198 (I198F)
Ref Sequence ENSEMBL: ENSMUSP00000076026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076737]
Predicted Effect probably damaging
Transcript: ENSMUST00000076737
AA Change: I198F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076026
Gene: ENSMUSG00000061928
AA Change: I198F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.45e-14 SMART
CA 179 267 3.11e-21 SMART
CA 290 384 6.29e-8 SMART
CA 407 491 3.92e-1 SMART
low complexity region 523 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Pfam:Cadherin_C 662 784 1.6e-10 PFAM
low complexity region 789 802 N/A INTRINSIC
low complexity region 884 896 N/A INTRINSIC
low complexity region 984 1006 N/A INTRINSIC
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Arhgap21 A C 2: 20,880,296 L690R probably benign Het
Asxl3 A G 18: 22,523,580 N1549S probably benign Het
Cast T C 13: 74,699,158 T670A possibly damaging Het
Cd109 A G 9: 78,714,955 D1409G probably benign Het
Cemip A G 7: 83,987,992 F311S probably damaging Het
Cfap43 T A 19: 47,756,085 I1210F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cops5 G A 1: 10,030,604 L256F probably benign Het
Cux1 T C 5: 136,373,173 probably null Het
Dab1 A G 4: 104,679,546 K178E probably damaging Het
Ddc A G 11: 11,824,854 Y346H probably damaging Het
Dlg2 T G 7: 91,965,664 D225E probably benign Het
Ect2l T C 10: 18,174,059 H155R probably benign Het
Epha2 A G 4: 141,308,994 H247R probably damaging Het
Esrp1 A G 4: 11,357,552 V355A probably damaging Het
Fam78b A G 1: 167,078,850 M193V possibly damaging Het
Gdpd4 A G 7: 97,957,830 T4A probably benign Het
Gm17175 T C 14: 51,573,021 N50D possibly damaging Het
Kcnt2 A G 1: 140,246,193 probably benign Het
Lpo T C 11: 87,809,241 N525D probably benign Het
Lrrc41 G A 4: 116,089,305 E406K possibly damaging Het
Lrrc59 G C 11: 94,630,065 D21H probably damaging Het
Mgat4a G A 1: 37,449,123 R472* probably null Het
Mroh7 C T 4: 106,714,115 A14T probably benign Het
Muc5b T C 7: 141,862,913 S3199P probably benign Het
Muc6 T A 7: 141,651,061 Y270F probably damaging Het
Myo18b T A 5: 112,830,238 T1273S probably benign Het
Nos2 A T 11: 78,945,266 E385V possibly damaging Het
Nsl1 T G 1: 191,063,274 probably null Het
Nup93 T C 8: 94,314,682 probably null Het
Olfr1175-ps A T 2: 88,322,763 M314K probably benign Het
Pcna-ps2 T G 19: 9,283,497 M40R probably damaging Het
Pik3r5 A G 11: 68,486,581 E148G probably damaging Het
Pirt A G 11: 66,925,911 E16G probably damaging Het
Pkp4 T C 2: 59,318,600 Y566H probably damaging Het
Psg17 A C 7: 18,814,640 V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rassf7 A G 7: 141,217,447 E191G probably damaging Het
Rnf213 T C 11: 119,462,285 probably null Het
Slc34a2 C T 5: 53,064,028 T272I probably damaging Het
Sos2 T C 12: 69,618,161 E332G probably benign Het
Spdye4c T C 2: 128,596,510 Y263H probably damaging Het
Tmprss11f C T 5: 86,556,934 V42I probably benign Het
Trpv5 T A 6: 41,658,007 N463Y possibly damaging Het
Ush2a A T 1: 188,862,864 Q3831L probably benign Het
Wdr41 C A 13: 94,997,304 probably null Het
Zfand1 A G 3: 10,340,824 C246R probably benign Het
Other mutations in Dsg1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dsg1b APN 18 20396476 missense probably damaging 1.00
IGL00675:Dsg1b APN 18 20391918 nonsense probably null
IGL01071:Dsg1b APN 18 20409215 missense probably damaging 1.00
IGL01589:Dsg1b APN 18 20409594 missense probably damaging 1.00
IGL01729:Dsg1b APN 18 20405238 missense possibly damaging 0.66
IGL01753:Dsg1b APN 18 20397849 splice site probably benign
IGL02560:Dsg1b APN 18 20409178 missense possibly damaging 0.80
IGL02654:Dsg1b APN 18 20409262 missense probably damaging 1.00
IGL02726:Dsg1b APN 18 20399485 missense probably benign
IGL03272:Dsg1b APN 18 20397389 missense probably benign 0.25
IGL03342:Dsg1b APN 18 20409460 missense probably benign 0.09
IGL02835:Dsg1b UTSW 18 20392014 missense possibly damaging 0.66
R0080:Dsg1b UTSW 18 20397367 missense probably damaging 1.00
R0133:Dsg1b UTSW 18 20404878 missense probably damaging 0.96
R0455:Dsg1b UTSW 18 20396025 missense probably benign 0.02
R0498:Dsg1b UTSW 18 20409333 missense possibly damaging 0.95
R0518:Dsg1b UTSW 18 20388164 missense probably benign 0.00
R1418:Dsg1b UTSW 18 20397430 nonsense probably null
R1429:Dsg1b UTSW 18 20390195 missense probably damaging 1.00
R1450:Dsg1b UTSW 18 20409184 missense probably damaging 1.00
R1569:Dsg1b UTSW 18 20396480 missense probably damaging 1.00
R1674:Dsg1b UTSW 18 20399521 missense probably benign
R1934:Dsg1b UTSW 18 20395906 missense probably damaging 1.00
R2004:Dsg1b UTSW 18 20396475 missense probably damaging 0.99
R2191:Dsg1b UTSW 18 20409618 makesense probably null
R2192:Dsg1b UTSW 18 20409618 makesense probably null
R2927:Dsg1b UTSW 18 20405251 missense probably benign 0.23
R3777:Dsg1b UTSW 18 20399587 missense probably damaging 1.00
R3801:Dsg1b UTSW 18 20390203 missense probably damaging 1.00
R4205:Dsg1b UTSW 18 20408821 missense probably damaging 1.00
R4718:Dsg1b UTSW 18 20397929 missense probably damaging 0.98
R4853:Dsg1b UTSW 18 20408736 missense probably benign 0.01
R4853:Dsg1b UTSW 18 20390132 critical splice acceptor site probably null
R4981:Dsg1b UTSW 18 20408868 missense possibly damaging 0.66
R5125:Dsg1b UTSW 18 20397503 missense probably damaging 1.00
R5178:Dsg1b UTSW 18 20397503 missense probably damaging 1.00
R5213:Dsg1b UTSW 18 20395930 missense probably damaging 1.00
R5450:Dsg1b UTSW 18 20409064 missense probably damaging 1.00
R5605:Dsg1b UTSW 18 20399539 missense probably benign
R5778:Dsg1b UTSW 18 20409222 missense possibly damaging 0.66
R5808:Dsg1b UTSW 18 20408725 missense probably damaging 1.00
R6144:Dsg1b UTSW 18 20396419 missense possibly damaging 0.92
R6185:Dsg1b UTSW 18 20399486 missense probably benign
R6268:Dsg1b UTSW 18 20388163 missense probably benign 0.01
R6291:Dsg1b UTSW 18 20404791 missense possibly damaging 0.71
R6342:Dsg1b UTSW 18 20390243 missense probably damaging 1.00
R6449:Dsg1b UTSW 18 20394441 missense possibly damaging 0.82
R6566:Dsg1b UTSW 18 20397442 missense probably damaging 1.00
R7235:Dsg1b UTSW 18 20399423 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGAGCTACTACATTGGTATATTGGTG -3'
(R):5'- CACTAACCTGACTCATATTTGTGTG -3'

Sequencing Primer
(F):5'- ACTACATTGGTATATTGGTGTTGTAC -3'
(R):5'- AGCTTGAGAGACATCCCCTTG -3'
Posted On2018-10-18