Incidental Mutation 'R6806:Itpr1'
ID537477
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Nameinositol 1,4,5-trisphosphate receptor 1
SynonymsP400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Is this an essential gene? Possibly essential (E-score: 0.740) question?
Stock #R6806 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location108213096-108551109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108515947 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 2478 (V2478I)
Ref Sequence ENSEMBL: ENSMUSP00000144880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615]
Predicted Effect probably benign
Transcript: ENSMUST00000032192
AA Change: V2479I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: V2479I

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203615
AA Change: V2478I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: V2478I

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (39/41)
MGI Phenotype Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,858 Q520R possibly damaging Het
9130019O22Rik T C 7: 127,386,594 probably benign Het
Agbl1 A G 7: 76,425,921 Y437C probably damaging Het
Apba2 T A 7: 64,695,459 D132E probably damaging Het
Atp13a4 A G 16: 29,469,280 S258P probably damaging Het
Bach2 T A 4: 32,575,301 M509K possibly damaging Het
Ccdc186 T A 19: 56,800,129 K549N probably damaging Het
Chrna3 C T 9: 55,015,810 R238H probably damaging Het
Cntnap5b G A 1: 99,940,649 C30Y probably damaging Het
Dnah11 T C 12: 117,987,676 probably null Het
Ebna1bp2 T C 4: 118,620,977 C16R probably benign Het
Gm884 T C 11: 103,621,124 E6G unknown Het
Grin2b A G 6: 135,774,828 Y579H possibly damaging Het
Ifi206 C T 1: 173,481,571 M286I probably benign Het
Ltbp2 T C 12: 84,809,238 S744G possibly damaging Het
Magi3 T A 3: 104,046,969 N684I possibly damaging Het
Muc16 A G 9: 18,537,910 probably null Het
Nphp4 G T 4: 152,538,101 Q614H probably benign Het
Nprl3 A G 11: 32,267,509 I11T probably damaging Het
Olfr635 G T 7: 103,979,564 R124L possibly damaging Het
Pank2 T C 2: 131,262,707 probably benign Het
Prss58 A T 6: 40,897,732 N58K probably damaging Het
Ptk7 C T 17: 46,573,528 V759M probably damaging Het
Rassf7 A G 7: 141,216,809 T28A probably damaging Het
Rbm45 C T 2: 76,380,460 T445I probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc2 T G 5: 123,739,531 probably benign Het
Saxo2 A T 7: 82,635,032 I206N probably benign Het
Sh3d19 T A 3: 86,104,333 Y409N probably damaging Het
Spata31d1a A T 13: 59,703,218 N365K probably benign Het
Stkld1 C G 2: 26,943,910 N136K probably benign Het
Tenm4 A G 7: 96,811,959 D904G possibly damaging Het
Tmf1 G A 6: 97,161,447 R837* probably null Het
Tnn T C 1: 160,120,708 T812A possibly damaging Het
Trgj4 T C 13: 19,342,195 L15P probably damaging Het
Trp53bp1 T C 2: 121,228,666 I905V probably damaging Het
Ubr3 T C 2: 69,955,964 probably benign Het
Zfp446 T C 7: 12,979,116 L27P probably damaging Het
Zfp719 A G 7: 43,586,385 D57G possibly damaging Het
Zfp978 G A 4: 147,390,827 R277K probably benign Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108471120 missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108413820 missense probably benign 0.00
IGL01105:Itpr1 APN 6 108381333 missense probably benign 0.00
IGL01296:Itpr1 APN 6 108399361 missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108381208 missense probably benign 0.01
IGL01418:Itpr1 APN 6 108339624 critical splice donor site probably null
IGL01464:Itpr1 APN 6 108386727 missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108488496 missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108473599 missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108381032 nonsense probably null
IGL01969:Itpr1 APN 6 108377691 missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108389483 missense probably benign 0.08
IGL02206:Itpr1 APN 6 108549820 missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108417923 missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108339517 missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108489922 splice site probably null
IGL02568:Itpr1 APN 6 108339554 missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108381315 missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108417981 missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108523401 missense probably benign 0.00
IGL03333:Itpr1 APN 6 108380910 unclassified probably benign
aboriginal UTSW 6 108515947 missense probably benign
approximation UTSW 6 108394841 missense probably benign
estimate UTSW 6 108389553 missense probably null 1.00
icarus UTSW 6 108410900 missense probably damaging 1.00
primordial UTSW 6 108518755 missense probably benign 0.06
roo UTSW 6 108410867 missense probably benign 0.00
wallaby UTSW 6 108389387 missense probably damaging 1.00
P0005:Itpr1 UTSW 6 108381257 missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108493757 nonsense probably null
R0019:Itpr1 UTSW 6 108354626 missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108471209 splice site probably benign
R0129:Itpr1 UTSW 6 108349676 missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108488482 splice site probably benign
R0244:Itpr1 UTSW 6 108473589 missense probably benign 0.00
R0391:Itpr1 UTSW 6 108378167 missense probably benign 0.22
R0543:Itpr1 UTSW 6 108515748 splice site probably benign
R0647:Itpr1 UTSW 6 108383698 missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108410900 missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108349629 missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108510696 missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108339621 missense probably benign 0.22
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1605:Itpr1 UTSW 6 108349659 missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108482897 missense probably benign 0.38
R1852:Itpr1 UTSW 6 108386706 missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108440536 missense probably benign 0.02
R2027:Itpr1 UTSW 6 108386853 missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108378309 unclassified probably benign
R2166:Itpr1 UTSW 6 108388225 missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108369110 missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108406109 missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108349680 missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108381270 missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108394841 missense probably benign
R4081:Itpr1 UTSW 6 108391835 missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108394355 missense probably benign
R4406:Itpr1 UTSW 6 108354663 missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108432686 missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108481223 missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108481293 missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108410931 critical splice donor site probably null
R4760:Itpr1 UTSW 6 108349632 missense probably benign 0.29
R4836:Itpr1 UTSW 6 108389537 missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108410867 missense probably benign 0.00
R4876:Itpr1 UTSW 6 108482906 missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108440558 nonsense probably null
R5076:Itpr1 UTSW 6 108405529 splice site probably null
R5088:Itpr1 UTSW 6 108389387 missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108542062 missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108406145 missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108356511 missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108393961 missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108387498 missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108519424 missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108493794 missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108488600 missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108352143 missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108510738 missense probably benign 0.23
R5869:Itpr1 UTSW 6 108473529 missense probably benign 0.30
R5903:Itpr1 UTSW 6 108489797 intron probably benign
R5929:Itpr1 UTSW 6 108423336 missense probably benign
R5956:Itpr1 UTSW 6 108506027 missense probably benign 0.25
R6160:Itpr1 UTSW 6 108518755 missense probably benign 0.06
R6163:Itpr1 UTSW 6 108388284 missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108369116 missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108378203 missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108505903 missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108417972 missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108388276 missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108363683 missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108394073 splice site probably null
R6838:Itpr1 UTSW 6 108471191 missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108388192 missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108481394 missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108431498 critical splice donor site probably null
R7076:Itpr1 UTSW 6 108388296 missense probably benign
R7116:Itpr1 UTSW 6 108481268 missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108394407 critical splice donor site probably null
R7161:Itpr1 UTSW 6 108386640 missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108378190 missense probably benign 0.06
R7241:Itpr1 UTSW 6 108517620 critical splice donor site probably null
R7301:Itpr1 UTSW 6 108542024 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAATCCCTTAACGACTCTTCTATCG -3'
(R):5'- TGGCCCTCACAACACAGTATTC -3'

Sequencing Primer
(F):5'- TTTAGTGTACAGAGAGGAGACTTTGC -3'
(R):5'- ACACAGTATTCAGCATTACCCTTTG -3'
Posted On2018-10-18