Incidental Mutation 'R6821:Pik3r4'
ID537631
Institutional Source Beutler Lab
Gene Symbol Pik3r4
Ensembl Gene ENSMUSG00000032571
Gene Namephosphoinositide-3-kinase regulatory subunit 4
SynonymsD9Ertd418e, 2210010O15Rik, C730038E05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6821 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location105642978-105687657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105650606 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 386 (L386Q)
Ref Sequence ENSEMBL: ENSMUSP00000139427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065778] [ENSMUST00000188784] [ENSMUST00000191268]
Predicted Effect probably damaging
Transcript: ENSMUST00000065778
AA Change: L386Q

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067400
Gene: ENSMUSG00000032571
AA Change: L386Q

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 1.7e-5 PFAM
Pfam:Pkinase 26 312 1.2e-18 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188784
SMART Domains Protein: ENSMUSP00000140988
Gene: ENSMUSG00000032571

DomainStartEndE-ValueType
S_TKc 26 301 2.8e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191268
AA Change: L386Q

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139427
Gene: ENSMUSG00000032571
AA Change: L386Q

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 8.9e-7 PFAM
Pfam:Pkinase 26 312 3.7e-23 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit earl embryonic lethality before E7.5. Mice homozygous for a conditional allele activated in muscles exhibit symptoms of autophagic vacuolar myopathies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,288,836 I417T probably benign Het
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
C2cd5 A G 6: 143,017,986 V891A probably damaging Het
Ccnt2 T C 1: 127,803,335 S650P probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Eif3d A G 15: 77,961,655 S389P possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm13089 A T 4: 143,699,304 L23* probably null Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Itm2b G A 14: 73,366,467 P47S probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mdh2 T C 5: 135,789,671 F260S possibly damaging Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Otoa G A 7: 121,092,847 probably null Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rad54b A G 4: 11,612,777 D803G probably damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Spast A G 17: 74,351,962 E108G probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Tsc22d4 T C 5: 137,762,644 V109A possibly damaging Het
Ttl G A 2: 129,068,915 R73H probably damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vdac3 T C 8: 22,580,475 Y140C probably damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Vmn2r17 T A 5: 109,429,465 Y461N probably damaging Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in Pik3r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Pik3r4 APN 9 105644604 missense possibly damaging 0.75
IGL01617:Pik3r4 APN 9 105654965 missense probably benign 0.33
IGL01764:Pik3r4 APN 9 105685122 splice site probably benign
IGL01817:Pik3r4 APN 9 105650822 missense probably damaging 1.00
IGL01830:Pik3r4 APN 9 105644955 missense probably damaging 1.00
IGL01905:Pik3r4 APN 9 105644878 nonsense probably null
IGL01947:Pik3r4 APN 9 105686150 missense possibly damaging 0.91
IGL01985:Pik3r4 APN 9 105663045 missense probably benign 0.03
IGL02321:Pik3r4 APN 9 105644478 missense probably benign 0.04
IGL02389:Pik3r4 APN 9 105650331 missense possibly damaging 0.88
IGL02898:Pik3r4 APN 9 105650406 missense probably benign 0.21
IGL03037:Pik3r4 APN 9 105650813 missense probably damaging 1.00
boteh UTSW 9 105667938 splice site probably null
IGL02835:Pik3r4 UTSW 9 105672706 missense probably benign 0.07
R0011:Pik3r4 UTSW 9 105644637 missense probably benign 0.01
R0312:Pik3r4 UTSW 9 105686210 missense probably damaging 1.00
R0321:Pik3r4 UTSW 9 105648707 missense probably damaging 1.00
R0482:Pik3r4 UTSW 9 105669045 missense probably benign 0.04
R0645:Pik3r4 UTSW 9 105669187 splice site probably benign
R0690:Pik3r4 UTSW 9 105653976 missense possibly damaging 0.81
R0789:Pik3r4 UTSW 9 105685167 missense probably benign 0.14
R0894:Pik3r4 UTSW 9 105667771 missense possibly damaging 0.73
R0988:Pik3r4 UTSW 9 105687205 missense probably damaging 0.97
R1123:Pik3r4 UTSW 9 105663129 missense probably benign
R1172:Pik3r4 UTSW 9 105663174 missense probably damaging 1.00
R1174:Pik3r4 UTSW 9 105663174 missense probably damaging 1.00
R1342:Pik3r4 UTSW 9 105650901 critical splice donor site probably null
R1387:Pik3r4 UTSW 9 105644291 missense probably damaging 1.00
R1480:Pik3r4 UTSW 9 105687244 missense probably benign 0.39
R1638:Pik3r4 UTSW 9 105687209 missense probably damaging 1.00
R1643:Pik3r4 UTSW 9 105687152 missense possibly damaging 0.83
R1995:Pik3r4 UTSW 9 105669165 missense probably benign 0.12
R2037:Pik3r4 UTSW 9 105650335 missense probably benign 0.00
R2165:Pik3r4 UTSW 9 105672785 missense probably benign 0.05
R4210:Pik3r4 UTSW 9 105650758 missense possibly damaging 0.57
R4515:Pik3r4 UTSW 9 105672725 missense probably damaging 1.00
R4519:Pik3r4 UTSW 9 105672725 missense probably damaging 1.00
R4630:Pik3r4 UTSW 9 105654899 missense probably benign 0.06
R4632:Pik3r4 UTSW 9 105654899 missense probably benign 0.06
R4732:Pik3r4 UTSW 9 105678176 missense possibly damaging 0.56
R4733:Pik3r4 UTSW 9 105678176 missense possibly damaging 0.56
R4940:Pik3r4 UTSW 9 105668994 missense probably benign 0.20
R5120:Pik3r4 UTSW 9 105669009 missense probably benign 0.30
R5169:Pik3r4 UTSW 9 105678161 missense probably benign 0.14
R5183:Pik3r4 UTSW 9 105682308 missense possibly damaging 0.87
R5353:Pik3r4 UTSW 9 105667938 splice site probably null
R5463:Pik3r4 UTSW 9 105648731 missense probably damaging 1.00
R5635:Pik3r4 UTSW 9 105667825 missense probably benign 0.01
R5763:Pik3r4 UTSW 9 105669775 missense probably benign 0.01
R5830:Pik3r4 UTSW 9 105644824 nonsense probably null
R6251:Pik3r4 UTSW 9 105654048 missense probably benign
R6468:Pik3r4 UTSW 9 105685190 missense possibly damaging 0.86
R6611:Pik3r4 UTSW 9 105644277 missense probably damaging 0.99
R6642:Pik3r4 UTSW 9 105644646 missense probably benign 0.11
R7039:Pik3r4 UTSW 9 105676890 missense possibly damaging 0.76
R7144:Pik3r4 UTSW 9 105650584 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTTCGCCAAGGAAACCTTTC -3'
(R):5'- TATGCCGGGGAGAATATACTCTG -3'

Sequencing Primer
(F):5'- GGAAACCTTTCTCTCTGCAGATGAG -3'
(R):5'- TATTGACATCGTTGCGAGGAACC -3'
Posted On2018-10-18