Incidental Mutation 'R6821:Eif3d'
ID537647
Institutional Source Beutler Lab
Gene Symbol Eif3d
Ensembl Gene ENSMUSG00000016554
Gene Nameeukaryotic translation initiation factor 3, subunit D
SynonymsEif3s7, eIF3p66, 66/67kDa, mouse translation initiation factor eIF3 p66
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6821 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location77958998-77970813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77961655 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 389 (S389P)
Ref Sequence ENSEMBL: ENSMUSP00000098053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016696] [ENSMUST00000100484] [ENSMUST00000117725] [ENSMUST00000230419]
Predicted Effect probably benign
Transcript: ENSMUST00000016696
SMART Domains Protein: ENSMUSP00000016696
Gene: ENSMUSG00000016552

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pyr_redox_2 22 243 2.9e-11 PFAM
Pfam:Pyr_redox_3 25 240 9.3e-35 PFAM
Pfam:NAD_binding_8 26 84 3.3e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100484
AA Change: S389P

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098053
Gene: ENSMUSG00000016554
AA Change: S389P

DomainStartEndE-ValueType
Pfam:eIF-3_zeta 4 521 6.3e-220 PFAM
low complexity region 530 547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117725
SMART Domains Protein: ENSMUSP00000113403
Gene: ENSMUSG00000016552

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pyr_redox_2 23 478 3.4e-9 PFAM
Pfam:Pyr_redox_3 25 240 6.2e-37 PFAM
Pfam:NAD_binding_8 26 90 4.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230419
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic translation initiation factor-3 (eIF3), the largest of the eIFs, is a multiprotein complex composed of at least ten nonidentical subunits. The complex binds to the 40S ribosome and helps maintain the 40S and 60S ribosomal subunits in a dissociated state. It is also thought to play a role in the formation of the 40S initiation complex by interacting with the ternary complex of eIF2/GTP/methionyl-tRNA, and by promoting mRNA binding. The protein encoded by this gene is the major RNA binding subunit of the eIF3 complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,288,836 I417T probably benign Het
Adamts12 A C 15: 11,152,048 K208T probably benign Het
Adamts8 T A 9: 30,956,626 L582Q probably benign Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Ano9 A T 7: 141,107,256 F357I possibly damaging Het
Aox3 T C 1: 58,150,388 V416A probably benign Het
Arhgap21 A C 2: 20,848,848 F1901C probably benign Het
Atp8b2 A T 3: 89,948,173 F506I probably damaging Het
Atp9b A T 18: 80,847,248 L292H probably damaging Het
C2cd5 A G 6: 143,017,986 V891A probably damaging Het
Ccnt2 T C 1: 127,803,335 S650P probably damaging Het
Cdhr3 T A 12: 33,035,045 N791Y probably damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 Het
D630003M21Rik A C 2: 158,204,774 L761R probably damaging Het
Draxin G T 4: 148,115,691 Q101K possibly damaging Het
Dtx3l A T 16: 35,933,060 L392Q probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha4 T C 1: 77,382,945 N757S possibly damaging Het
Fam228b T C 12: 4,763,083 I96V probably benign Het
Gars A G 6: 55,079,338 E728G probably benign Het
Gldn T C 9: 54,338,770 M535T probably benign Het
Gm13089 A T 4: 143,699,304 L23* probably null Het
Gm47985 A G 1: 151,183,036 T143A possibly damaging Het
Gpr6 T C 10: 41,071,008 T193A probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hecw1 T A 13: 14,264,134 Y1315F probably damaging Het
Hs3st2 A G 7: 121,500,522 D197G possibly damaging Het
Igsf9 T C 1: 172,484,493 I2T probably benign Het
Ints9 A G 14: 65,037,458 E621G probably benign Het
Itm2b G A 14: 73,366,467 P47S probably benign Het
Map10 A G 8: 125,670,399 K177R probably benign Het
Mdh2 T C 5: 135,789,671 F260S possibly damaging Het
Mtmr11 A G 3: 96,170,407 T573A probably benign Het
Mycbp2 A T 14: 103,139,409 I3812N probably damaging Het
Myo15 A G 11: 60,524,475 N3403S probably damaging Het
Nvl G A 1: 181,126,970 Q343* probably null Het
Ocstamp A T 2: 165,397,922 S115T probably benign Het
Olfr632 A T 7: 103,937,586 I69F probably benign Het
Otoa G A 7: 121,092,847 probably null Het
Pcdhb20 A T 18: 37,506,122 N567I probably damaging Het
Pgm5 A T 19: 24,861,647 V48E possibly damaging Het
Phlpp1 T A 1: 106,386,444 S1182R probably damaging Het
Pik3r4 T A 9: 105,650,606 L386Q probably damaging Het
Pop1 A G 15: 34,508,639 K287E possibly damaging Het
Rad54b A G 4: 11,612,777 D803G probably damaging Het
Rbm26 G A 14: 105,116,964 probably benign Het
Rspry1 C T 8: 94,635,431 Q113* probably null Het
Siah2 T A 3: 58,691,770 S16C probably benign Het
Sirpa C A 2: 129,630,097 D481E probably damaging Het
Slc38a7 A C 8: 95,844,920 D227E probably benign Het
Smc5 A G 19: 23,242,787 V438A probably benign Het
Spast A G 17: 74,351,962 E108G probably benign Het
Speg A G 1: 75,417,903 E1752G possibly damaging Het
Tanc2 T G 11: 105,886,490 probably null Het
Tgfbi T C 13: 56,626,137 I243T possibly damaging Het
Tlr12 T C 4: 128,616,892 S522G possibly damaging Het
Trav14-3 A G 14: 53,763,472 I47V probably benign Het
Tsc22d4 T C 5: 137,762,644 V109A possibly damaging Het
Ttl G A 2: 129,068,915 R73H probably damaging Het
Usp34 C T 11: 23,367,491 T850I possibly damaging Het
Vdac3 T C 8: 22,580,475 Y140C probably damaging Het
Vmn2r120 T C 17: 57,536,659 R62G probably benign Het
Vmn2r17 T A 5: 109,429,465 Y461N probably damaging Het
Wt1 T A 2: 105,172,267 F493I probably damaging Het
Other mutations in Eif3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Eif3d APN 15 77961869 missense probably benign
IGL01082:Eif3d APN 15 77959743 missense probably damaging 0.99
IGL01113:Eif3d APN 15 77963315 missense probably damaging 1.00
IGL01865:Eif3d APN 15 77967346 missense probably benign 0.34
IGL03070:Eif3d APN 15 77959643 missense probably damaging 1.00
IGL03277:Eif3d APN 15 77959649 missense possibly damaging 0.50
R0049:Eif3d UTSW 15 77959724 missense probably benign 0.01
R0049:Eif3d UTSW 15 77959724 missense probably benign 0.01
R0325:Eif3d UTSW 15 77968220 missense probably damaging 1.00
R1346:Eif3d UTSW 15 77968554 missense probably damaging 1.00
R2219:Eif3d UTSW 15 77964942 missense probably benign 0.35
R2993:Eif3d UTSW 15 77961705 missense possibly damaging 0.85
R3796:Eif3d UTSW 15 77968569 missense probably damaging 1.00
R3797:Eif3d UTSW 15 77968569 missense probably damaging 1.00
R3839:Eif3d UTSW 15 77964100 missense probably benign 0.30
R4690:Eif3d UTSW 15 77967316 missense probably benign 0.06
R4828:Eif3d UTSW 15 77960029 nonsense probably null
R5411:Eif3d UTSW 15 77959687 missense probably damaging 1.00
R5558:Eif3d UTSW 15 77961847 missense probably damaging 1.00
R6764:Eif3d UTSW 15 77961686 missense probably damaging 1.00
R7176:Eif3d UTSW 15 77963234 missense probably damaging 1.00
R7322:Eif3d UTSW 15 77961676 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CAAGATCAGATGCGGAGACC -3'
(R):5'- AAGAATGAGATCGCCTCCGTC -3'

Sequencing Primer
(F):5'- CCAGAATGAATAGACCAAAGTACCGG -3'
(R):5'- TCCGTCGCTTACCGGTAAG -3'
Posted On2018-10-18