Incidental Mutation 'R6823:Wdr59'
ID537738
Institutional Source Beutler Lab
Gene Symbol Wdr59
Ensembl Gene ENSMUSG00000031959
Gene NameWD repeat domain 59
Synonyms5430401O09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R6823 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location111448797-111522092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111459040 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 810 (E810V)
Ref Sequence ENSEMBL: ENSMUSP00000043671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034437] [ENSMUST00000038193] [ENSMUST00000211981]
Predicted Effect probably benign
Transcript: ENSMUST00000034437
AA Change: E829V

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034437
Gene: ENSMUSG00000031959
AA Change: E829V

DomainStartEndE-ValueType
WD40 41 91 1.37e2 SMART
WD40 94 134 9.52e-6 SMART
WD40 138 176 4.46e-1 SMART
WD40 180 220 2.59e-7 SMART
WD40 271 315 8.59e-1 SMART
RWD 393 494 4.13e-14 SMART
low complexity region 620 632 N/A INTRINSIC
low complexity region 802 813 N/A INTRINSIC
Blast:RING 941 980 3e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000038193
AA Change: E810V

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043671
Gene: ENSMUSG00000031959
AA Change: E810V

DomainStartEndE-ValueType
WD40 41 91 1.37e2 SMART
WD40 94 134 9.52e-6 SMART
WD40 138 176 4.46e-1 SMART
WD40 180 220 2.59e-7 SMART
WD40 271 315 8.59e-1 SMART
RWD 393 494 4.13e-14 SMART
low complexity region 803 814 N/A INTRINSIC
Pfam:Zn_ribbon_17 937 992 2e-14 PFAM
Pfam:zinc_ribbon_16 949 990 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211981
AA Change: E827V

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (81/83)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,754,886 probably null Het
Adgrv1 A G 13: 81,557,081 F1537L probably damaging Het
Aggf1 T C 13: 95,364,723 S384G probably benign Het
Anxa8 A T 14: 34,094,765 D204V possibly damaging Het
Asap3 A T 4: 136,227,572 E71V possibly damaging Het
BC024139 T C 15: 76,119,746 *773W probably null Het
Bckdhb T C 9: 83,953,761 V106A possibly damaging Het
Cep250 A G 2: 155,981,459 D1010G probably benign Het
Chrd T A 16: 20,734,736 L243Q probably damaging Het
Cib2 G T 9: 54,549,891 L30I possibly damaging Het
Cpsf7 T A 19: 10,532,884 L113* probably null Het
Cubn T A 2: 13,445,029 I895L probably benign Het
Cyp24a1 C A 2: 170,487,979 R351I probably benign Het
Cyp2a12 A T 7: 27,034,156 D320V possibly damaging Het
Dact1 C G 12: 71,317,939 P498R probably benign Het
Diaph1 T A 18: 37,876,383 probably null Het
Dnah7a A T 1: 53,456,704 I3198N probably benign Het
Dopey2 A T 16: 93,755,485 I271F possibly damaging Het
Erich3 C A 3: 154,727,437 F349L probably damaging Het
Fam187b G C 7: 30,989,290 V358L probably benign Het
Fat4 T A 3: 38,983,939 H3913Q probably benign Het
Fbxw7 G C 3: 84,958,627 E118D probably benign Het
Fgf1 A G 18: 38,847,108 I71T probably damaging Het
Fryl A T 5: 73,065,217 I2007K probably damaging Het
Galnt2 C G 8: 124,324,011 P130A probably benign Het
H1fx G A 6: 87,981,302 R19C probably damaging Het
Hmga2 A C 10: 120,476,024 S14A possibly damaging Het
Hoxb4 C T 11: 96,318,654 probably benign Het
Hr A T 14: 70,565,374 I756F probably damaging Het
Hrasls5 A T 19: 7,639,496 probably benign Het
Hspa1b A T 17: 34,958,185 S275T probably benign Het
Ikbkap A G 4: 56,787,939 Y331H probably damaging Het
Kcnh1 T C 1: 192,505,289 *99R probably null Het
Kit C A 5: 75,652,649 L864I probably benign Het
Klk14 A T 7: 43,694,456 K196* probably null Het
Lmod1 A G 1: 135,325,167 N53S probably damaging Het
Myh13 T C 11: 67,356,158 M1235T probably benign Het
Neurl3 T A 1: 36,268,704 K175* probably null Het
Nlgn2 T A 11: 69,825,924 K597M probably damaging Het
Npdc1 T C 2: 25,409,109 M306T probably damaging Het
Obscn C T 11: 59,067,943 probably null Het
Olfr404-ps1 T C 11: 74,239,696 L44P probably damaging Het
Olfr553 G A 7: 102,614,486 L168F probably damaging Het
Olfr913 T C 9: 38,594,905 I228T possibly damaging Het
Pbrm1 A T 14: 31,084,790 Y1042F probably damaging Het
Pclo T A 5: 14,677,907 probably benign Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Phf12 C T 11: 78,022,511 Q430* probably null Het
Pld3 C T 7: 27,535,897 R302H probably damaging Het
Plekha5 T C 6: 140,525,858 S112P probably benign Het
Pmfbp1 T A 8: 109,530,307 S548T possibly damaging Het
Ppa1 A T 10: 61,667,603 I220F probably damaging Het
Ppp2r3d A G 9: 124,439,078 probably benign Het
Psmg2 A T 18: 67,648,857 E164D possibly damaging Het
Rarb T C 14: 16,443,824 R155G probably damaging Het
Rnf215 T C 11: 4,136,609 L162S probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Rtkn2 G A 10: 68,026,632 V330M probably damaging Het
Slc16a4 A T 3: 107,311,498 I472F probably benign Het
Snx14 T C 9: 88,394,382 N617D possibly damaging Het
Spire2 T C 8: 123,356,727 V150A probably damaging Het
Sptbn1 C A 11: 30,114,787 R1904M probably damaging Het
Swap70 A G 7: 110,281,303 E575G possibly damaging Het
Tbxas1 A T 6: 38,919,153 M1L possibly damaging Het
Tenm3 A T 8: 48,256,837 V1688D probably damaging Het
Tgfbr3 A T 5: 107,149,914 S207T probably damaging Het
Timm44 A G 8: 4,267,282 F248L probably damaging Het
Tmem161a T C 8: 70,181,199 L170P probably damaging Het
Tmem63a A T 1: 180,960,470 Y263F possibly damaging Het
Tnfsf9 C A 17: 57,105,513 L28I probably benign Het
Tph2 T A 10: 115,174,106 N183I probably benign Het
Ttyh1 T C 7: 4,122,529 I60T probably damaging Het
Ubn1 T G 16: 5,064,547 S48A probably damaging Het
Ubr5 T C 15: 37,989,598 N2019S probably benign Het
Wbp2 T C 11: 116,086,910 N6D probably benign Het
Wiz T C 17: 32,360,421 D220G probably damaging Het
Yipf7 A G 5: 69,517,070 L244P probably damaging Het
Zdhhc17 T C 10: 110,955,111 T366A possibly damaging Het
Zfp169 A T 13: 48,490,996 probably benign Het
Zfp707 C T 15: 75,969,723 probably benign Het
Zfp788 A G 7: 41,649,560 H540R probably damaging Het
Other mutations in Wdr59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Wdr59 APN 8 111458736 missense probably damaging 0.98
IGL01330:Wdr59 APN 8 111481933 missense possibly damaging 0.87
IGL01413:Wdr59 APN 8 111501074 missense probably benign 0.23
IGL02306:Wdr59 APN 8 111492733 missense probably damaging 1.00
IGL03027:Wdr59 APN 8 111462192 missense probably damaging 1.00
IGL03057:Wdr59 APN 8 111476118 missense probably damaging 1.00
IGL03204:Wdr59 APN 8 111485370 missense probably benign 0.05
R0056:Wdr59 UTSW 8 111480607 splice site probably benign
R0096:Wdr59 UTSW 8 111504373 missense probably damaging 1.00
R0096:Wdr59 UTSW 8 111504373 missense probably damaging 1.00
R0440:Wdr59 UTSW 8 111480540 small deletion probably benign
R0452:Wdr59 UTSW 8 111521972 missense possibly damaging 0.87
R0472:Wdr59 UTSW 8 111486997 critical splice acceptor site probably null
R0501:Wdr59 UTSW 8 111458947 missense possibly damaging 0.90
R0526:Wdr59 UTSW 8 111480540 small deletion probably benign
R0534:Wdr59 UTSW 8 111480540 small deletion probably benign
R0601:Wdr59 UTSW 8 111480540 small deletion probably benign
R1144:Wdr59 UTSW 8 111486944 missense probably benign 0.09
R1415:Wdr59 UTSW 8 111498596 missense probably damaging 1.00
R1571:Wdr59 UTSW 8 111451050 missense probably damaging 0.98
R1661:Wdr59 UTSW 8 111479362 missense probably damaging 1.00
R1665:Wdr59 UTSW 8 111479362 missense probably damaging 1.00
R1839:Wdr59 UTSW 8 111485340 missense probably benign
R1856:Wdr59 UTSW 8 111476181 missense probably damaging 1.00
R1872:Wdr59 UTSW 8 111459017 missense probably damaging 1.00
R1921:Wdr59 UTSW 8 111486950 nonsense probably null
R1965:Wdr59 UTSW 8 111451077 missense probably damaging 1.00
R1966:Wdr59 UTSW 8 111450903 missense possibly damaging 0.92
R1977:Wdr59 UTSW 8 111458638 missense probably benign 0.00
R2019:Wdr59 UTSW 8 111466793 missense probably damaging 1.00
R4245:Wdr59 UTSW 8 111490364 missense possibly damaging 0.63
R4471:Wdr59 UTSW 8 111466787 critical splice donor site probably null
R4820:Wdr59 UTSW 8 111480814 missense probably benign 0.19
R5198:Wdr59 UTSW 8 111481988 missense probably benign 0.00
R5540:Wdr59 UTSW 8 111485184 missense possibly damaging 0.84
R5571:Wdr59 UTSW 8 111465831 missense probably damaging 1.00
R6166:Wdr59 UTSW 8 111472661 missense probably damaging 1.00
R6732:Wdr59 UTSW 8 111501052 missense probably damaging 1.00
R6767:Wdr59 UTSW 8 111476101 missense probably damaging 1.00
R6841:Wdr59 UTSW 8 111496880 missense probably damaging 1.00
R6888:Wdr59 UTSW 8 111451043 missense probably benign 0.00
R6974:Wdr59 UTSW 8 111460788 missense possibly damaging 0.86
R6982:Wdr59 UTSW 8 111460813 missense probably benign 0.00
R7066:Wdr59 UTSW 8 111465845 missense probably benign 0.07
X0026:Wdr59 UTSW 8 111479340 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AATTCTGTAGCTGCCACAGGG -3'
(R):5'- TATCATGTGTACCAGGCTCTCTTG -3'

Sequencing Primer
(F):5'- CTGCCACAGGGAAGGTG -3'
(R):5'- GTACCAGGCTCTCTTGGTGATAAATC -3'
Posted On2018-10-18