Incidental Mutation 'R6831:B020004J07Rik'
ID537836
Institutional Source Beutler Lab
Gene Symbol B020004J07Rik
Ensembl Gene ENSMUSG00000035201
Gene NameRIKEN cDNA B020004J07 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6831 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location101834969-101844023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101836897 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 263 (Q263L)
Ref Sequence ENSEMBL: ENSMUSP00000102532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084386] [ENSMUST00000106919]
Predicted Effect probably benign
Transcript: ENSMUST00000084386
AA Change: Q263L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000081421
Gene: ENSMUSG00000035201
AA Change: Q263L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 219 405 2e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106919
AA Change: Q263L

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102532
Gene: ENSMUSG00000035201
AA Change: Q263L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 219 405 2e-10 SMART
Meta Mutation Damage Score 0.0948 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T G 10: 29,224,679 D349E probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Akr1cl C T 1: 65,014,672 probably null Het
Alcam A G 16: 52,309,901 Y29H probably benign Het
Alg3 A T 16: 20,608,747 S25T probably damaging Het
Amdhd1 T G 10: 93,527,256 L323F probably damaging Het
Apcdd1 C A 18: 62,950,126 Y342* probably null Het
Aqp9 T A 9: 71,162,420 probably benign Het
Arhgef5 A G 6: 43,280,999 T1326A probably damaging Het
Cacna1a T C 8: 84,571,231 V1238A probably damaging Het
Cep128 T C 12: 91,266,974 D440G probably damaging Het
Dnah5 G C 15: 28,411,515 G3677R possibly damaging Het
Dst T A 1: 34,190,684 C2631S probably benign Het
E330034G19Rik T C 14: 24,296,095 S25P probably benign Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fat3 C A 9: 16,376,551 V559L probably damaging Het
Fra10ac1 A T 19: 38,207,289 I162K probably benign Het
Glrx3 C T 7: 137,459,222 T195M possibly damaging Het
Gm9268 G C 7: 43,023,580 A143P probably damaging Het
Gm9949 T A 18: 62,180,545 probably benign Het
Hbs1l T C 10: 21,341,868 S228P probably benign Het
Hmcn1 G A 1: 150,770,293 T718I probably benign Het
Igf1r T C 7: 68,207,319 S1010P possibly damaging Het
Inpp5d T A 1: 87,701,476 Y394* probably null Het
Itpr2 G A 6: 146,112,429 T2623M probably damaging Het
Kif21b T A 1: 136,144,758 C67* probably null Het
Lama1 T A 17: 67,756,754 C758S possibly damaging Het
Mdga1 T A 17: 29,887,516 K274* probably null Het
Neu2 G A 1: 87,596,733 G147R probably damaging Het
Nkx1-1 A T 5: 33,433,803 S58R unknown Het
Olfr677 A G 7: 105,056,879 D211G possibly damaging Het
Olfr698 A T 7: 106,752,571 N272K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacs1 T A 19: 5,160,795 I151F probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pclo C T 5: 14,788,429 Q1417* probably null Het
Pkm G C 9: 59,675,115 M409I probably benign Het
Plbd2 T A 5: 120,493,066 K215N probably benign Het
Polk T C 13: 96,495,491 K245E possibly damaging Het
Prl T G 13: 27,059,547 I65S probably benign Het
Proser3 T C 7: 30,540,356 H441R probably benign Het
Psmb3 A G 11: 97,706,902 K98R probably benign Het
Ptpn20 T C 14: 33,632,925 V319A probably damaging Het
Ptprj A T 2: 90,460,647 Y397N probably damaging Het
Rp1 T C 1: 4,349,864 probably null Het
Sgsm1 T A 5: 113,280,380 Y314F probably damaging Het
Sh3pxd2a G A 19: 47,283,093 R244C probably damaging Het
Sspo G A 6: 48,484,833 V3466M possibly damaging Het
Syne2 T A 12: 75,966,794 F2921I probably benign Het
Trank1 T A 9: 111,377,899 M1700K probably benign Het
Trmt112 T A 19: 6,910,195 L4H probably damaging Het
Trmu A G 15: 85,895,006 T285A probably benign Het
Ttn A G 2: 76,771,502 probably null Het
Zc3hav1 A T 6: 38,332,168 M573K probably benign Het
Zcchc8 T C 5: 123,700,909 E522G probably damaging Het
Zfp354a T C 11: 51,070,554 S529P probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in B020004J07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:B020004J07Rik APN 4 101835532 missense probably benign
IGL01615:B020004J07Rik APN 4 101837004 missense possibly damaging 0.63
IGL01765:B020004J07Rik APN 4 101837852 missense probably benign 0.03
IGL02228:B020004J07Rik APN 4 101836858 missense probably benign 0.03
IGL02276:B020004J07Rik APN 4 101838109 missense possibly damaging 0.89
IGL02548:B020004J07Rik APN 4 101835573 missense probably damaging 0.99
IGL03226:B020004J07Rik APN 4 101835397 missense probably benign 0.00
R0124:B020004J07Rik UTSW 4 101835373 makesense probably null
R0449:B020004J07Rik UTSW 4 101836961 missense probably benign 0.01
R0573:B020004J07Rik UTSW 4 101835414 missense probably damaging 0.96
R1159:B020004J07Rik UTSW 4 101838027 missense possibly damaging 0.54
R1689:B020004J07Rik UTSW 4 101837179 missense possibly damaging 0.63
R1857:B020004J07Rik UTSW 4 101835573 missense probably damaging 1.00
R1861:B020004J07Rik UTSW 4 101836938 missense probably benign
R2570:B020004J07Rik UTSW 4 101837246 missense probably benign 0.01
R3886:B020004J07Rik UTSW 4 101835723 missense probably benign 0.09
R4922:B020004J07Rik UTSW 4 101835532 missense probably benign
R4984:B020004J07Rik UTSW 4 101835599 missense possibly damaging 0.63
R5503:B020004J07Rik UTSW 4 101835802 missense probably benign 0.00
R6230:B020004J07Rik UTSW 4 101837214 missense probably damaging 0.96
R7172:B020004J07Rik UTSW 4 101836996 missense probably benign 0.00
R7201:B020004J07Rik UTSW 4 101838141 critical splice acceptor site probably null
R7220:B020004J07Rik UTSW 4 101837368 missense probably benign 0.00
R7253:B020004J07Rik UTSW 4 101835528 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CCAGCTCAGAGTCTGCTAAAGG -3'
(R):5'- CACACACGAGAGGTCATGTC -3'

Sequencing Primer
(F):5'- TCTGCTAAAGGAGTGGGTATTGAACC -3'
(R):5'- ACGAGAGGTCATGTCCTTCCTAG -3'
Posted On2018-10-18