Incidental Mutation 'R6837:Yars'
ID537890
Institutional Source Beutler Lab
Gene Symbol Yars
Ensembl Gene ENSMUSG00000028811
Gene Nametyrosyl-tRNA synthetase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R6837 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location129189760-129219607 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129209751 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 298 (S298T)
Ref Sequence ENSEMBL: ENSMUSP00000101669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106054]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106054
AA Change: S298T

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101669
Gene: ENSMUSG00000028811
AA Change: S298T

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:tRNA-synt_1b 67 358 1e-78 PFAM
Pfam:tRNA_bind 406 502 7.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133992
SMART Domains Protein: ENSMUSP00000118512
Gene: ENSMUSG00000028811

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 1 75 2.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Tyrosyl-tRNA synthetase belongs to the class I tRNA synthetase family. Cytokine activities have also been observed for the human tyrosyl-tRNA synthetase, after it is split into two parts, an N-terminal fragment that harbors the catalytic site and a C-terminal fragment found only in the mammalian enzyme. The N-terminal fragment is an interleukin-8-like cytokine, whereas the released C-terminal fragment is an EMAP II-like cytokine. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 G A 12: 53,141,262 E1820K probably damaging Het
Anxa8 A T 14: 34,092,554 I116F probably damaging Het
Arid4a A G 12: 71,075,515 D890G probably benign Het
Aup1 C T 6: 83,057,298 T396I possibly damaging Het
C2cd3 G C 7: 100,448,746 E594Q probably damaging Het
Colgalt2 C T 1: 152,506,828 P477L probably damaging Het
D11Wsu47e A G 11: 113,688,613 H278R possibly damaging Het
Dennd3 G A 15: 73,557,693 D20N probably damaging Het
Dpysl3 A G 18: 43,437,882 I109T probably benign Het
Fas A T 19: 34,307,164 T24S probably damaging Het
Fras1 A T 5: 96,726,973 I2332F probably damaging Het
Gm10267 T C 18: 44,158,308 H32R probably benign Het
Hcfc2 A T 10: 82,739,196 I230F probably damaging Het
Hdac9 T C 12: 34,287,464 T673A probably benign Het
Herc2 T G 7: 56,189,841 N3366K possibly damaging Het
Hhla1 T C 15: 65,948,485 N139D probably damaging Het
Hip1r A G 5: 123,998,865 E632G possibly damaging Het
Kcnc2 A G 10: 112,458,502 D98G probably damaging Het
Maip1 T A 1: 57,415,732 *292K probably null Het
Map2 T C 1: 66,414,572 F874L probably damaging Het
Myof A T 19: 37,922,956 probably null Het
Notch2 A G 3: 98,070,854 probably null Het
Npy5r T A 8: 66,681,740 M134L probably benign Het
Ntsr2 T A 12: 16,659,709 M225K probably benign Het
Nup153 G A 13: 46,694,051 T634I probably damaging Het
Olfr583 T A 7: 103,051,722 Y141* probably null Het
Pcsk5 T C 19: 17,439,084 S1667G probably benign Het
Pex13 A G 11: 23,649,527 I328T possibly damaging Het
Pkd2 T G 5: 104,477,043 L235W probably damaging Het
Prune2 A T 19: 17,178,928 D66V probably damaging Het
Rasal3 T C 17: 32,403,070 N105S probably benign Het
Sla A T 15: 66,787,090 I144N probably damaging Het
Slc5a4b A T 10: 76,062,386 I498N possibly damaging Het
Snx14 C T 9: 88,380,223 E872K probably benign Het
Stx16 G A 2: 174,094,002 R242H probably benign Het
Tg T C 15: 66,696,135 F1296S probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmf1 G A 6: 97,176,581 T177M possibly damaging Het
Tuba4a T C 1: 75,217,394 Q14R probably damaging Het
Vmn2r114 T C 17: 23,310,202 M309V probably benign Het
Vps13c C T 9: 67,910,222 P1059S probably benign Het
Other mutations in Yars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Yars APN 4 129206142 missense probably damaging 1.00
IGL02039:Yars APN 4 129215259 missense probably damaging 1.00
IGL03324:Yars APN 4 129210535 missense probably benign 0.01
R0023:Yars UTSW 4 129197188 missense probably benign 0.08
R0023:Yars UTSW 4 129197188 missense probably benign 0.08
R0646:Yars UTSW 4 129213939 unclassified probably benign
R0746:Yars UTSW 4 129197286 missense probably damaging 1.00
R0894:Yars UTSW 4 129197155 missense probably damaging 0.97
R2115:Yars UTSW 4 129207923 intron probably null
R2134:Yars UTSW 4 129197199 nonsense probably null
R2189:Yars UTSW 4 129206189 missense probably damaging 1.00
R4190:Yars UTSW 4 129200027 nonsense probably null
R4863:Yars UTSW 4 129189882 unclassified probably benign
R4915:Yars UTSW 4 129210591 unclassified probably benign
R5450:Yars UTSW 4 129197246 missense possibly damaging 0.94
R5631:Yars UTSW 4 129209749 missense probably damaging 1.00
R5789:Yars UTSW 4 129196897 missense probably damaging 1.00
R6384:Yars UTSW 4 129196978 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCTGGGTTACGTGCAGTCC -3'
(R):5'- AGTCTCACAGCACACATTTTG -3'

Sequencing Primer
(F):5'- GTTACGTGCAGTCCTAGCTCAAAAG -3'
(R):5'- TTTGTATATGAAACCAGGGCAGCC -3'
Posted On2018-10-18