Incidental Mutation 'R6837:Arid4a'
ID537910
Institutional Source Beutler Lab
Gene Symbol Arid4a
Ensembl Gene ENSMUSG00000048118
Gene NameAT rich interactive domain 4A (RBP1-like)
SynonymsRbbp1, A630067N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6837 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location71015990-71098592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71075515 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 890 (D890G)
Ref Sequence ENSEMBL: ENSMUSP00000035512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046305] [ENSMUST00000135709]
Predicted Effect probably benign
Transcript: ENSMUST00000046305
AA Change: D890G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118
AA Change: D890G

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TUDOR 58 114 3.6e-12 SMART
low complexity region 152 167 N/A INTRINSIC
Pfam:RBB1NT 170 262 4e-32 PFAM
ARID 306 397 6.7e-37 SMART
BRIGHT 310 402 2.3e-40 SMART
low complexity region 411 422 N/A INTRINSIC
CHROMO 483 652 6.8e-6 SMART
low complexity region 690 707 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 991 1003 N/A INTRINSIC
coiled coil region 1185 1224 N/A INTRINSIC
low complexity region 1229 1252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135709
SMART Domains Protein: ENSMUSP00000121319
Gene: ENSMUSG00000048118

DomainStartEndE-ValueType
ARID 1 75 1.02e-16 SMART
BRIGHT 1 80 2.05e-23 SMART
low complexity region 89 100 N/A INTRINSIC
CHROMO 161 330 1.08e-3 SMART
low complexity region 368 385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 G A 12: 53,141,262 E1820K probably damaging Het
Anxa8 A T 14: 34,092,554 I116F probably damaging Het
Aup1 C T 6: 83,057,298 T396I possibly damaging Het
C2cd3 G C 7: 100,448,746 E594Q probably damaging Het
Colgalt2 C T 1: 152,506,828 P477L probably damaging Het
D11Wsu47e A G 11: 113,688,613 H278R possibly damaging Het
Dennd3 G A 15: 73,557,693 D20N probably damaging Het
Dpysl3 A G 18: 43,437,882 I109T probably benign Het
Fas A T 19: 34,307,164 T24S probably damaging Het
Fras1 A T 5: 96,726,973 I2332F probably damaging Het
Gm10267 T C 18: 44,158,308 H32R probably benign Het
Hcfc2 A T 10: 82,739,196 I230F probably damaging Het
Hdac9 T C 12: 34,287,464 T673A probably benign Het
Herc2 T G 7: 56,189,841 N3366K possibly damaging Het
Hhla1 T C 15: 65,948,485 N139D probably damaging Het
Hip1r A G 5: 123,998,865 E632G possibly damaging Het
Kcnc2 A G 10: 112,458,502 D98G probably damaging Het
Maip1 T A 1: 57,415,732 *292K probably null Het
Map2 T C 1: 66,414,572 F874L probably damaging Het
Myof A T 19: 37,922,956 probably null Het
Notch2 A G 3: 98,070,854 probably null Het
Npy5r T A 8: 66,681,740 M134L probably benign Het
Ntsr2 T A 12: 16,659,709 M225K probably benign Het
Nup153 G A 13: 46,694,051 T634I probably damaging Het
Olfr583 T A 7: 103,051,722 Y141* probably null Het
Pcsk5 T C 19: 17,439,084 S1667G probably benign Het
Pex13 A G 11: 23,649,527 I328T possibly damaging Het
Pkd2 T G 5: 104,477,043 L235W probably damaging Het
Prune2 A T 19: 17,178,928 D66V probably damaging Het
Rasal3 T C 17: 32,403,070 N105S probably benign Het
Sla A T 15: 66,787,090 I144N probably damaging Het
Slc5a4b A T 10: 76,062,386 I498N possibly damaging Het
Snx14 C T 9: 88,380,223 E872K probably benign Het
Stx16 G A 2: 174,094,002 R242H probably benign Het
Tg T C 15: 66,696,135 F1296S probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmf1 G A 6: 97,176,581 T177M possibly damaging Het
Tuba4a T C 1: 75,217,394 Q14R probably damaging Het
Vmn2r114 T C 17: 23,310,202 M309V probably benign Het
Vps13c C T 9: 67,910,222 P1059S probably benign Het
Yars T A 4: 129,209,751 S298T possibly damaging Het
Other mutations in Arid4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Arid4a APN 12 71072593 missense probably damaging 1.00
IGL00546:Arid4a APN 12 71075671 missense probably benign
IGL00553:Arid4a APN 12 71075977 missense probably benign 0.04
IGL00708:Arid4a APN 12 71072728 missense probably benign 0.02
IGL00847:Arid4a APN 12 71075718 missense probably damaging 1.00
IGL01112:Arid4a APN 12 71072733 critical splice donor site probably null
IGL01456:Arid4a APN 12 71067262 missense probably benign 0.00
IGL01505:Arid4a APN 12 71037115 missense probably damaging 1.00
IGL01555:Arid4a APN 12 71061527 splice site probably benign
IGL01631:Arid4a APN 12 71022262 splice site probably benign
IGL02958:Arid4a APN 12 71097563 missense probably benign 0.01
IGL03087:Arid4a APN 12 71075245 missense possibly damaging 0.94
IGL03111:Arid4a APN 12 71039966 missense probably damaging 1.00
IGL03234:Arid4a APN 12 71045060 missense probably benign 0.34
after_8 UTSW 12 71023498 critical splice acceptor site probably null
ariano UTSW 12 71069860 nonsense probably null
guava UTSW 12 71072632 missense probably damaging 0.99
under_8 UTSW 12 71063206 missense probably benign 0.10
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0270:Arid4a UTSW 12 71072632 missense probably damaging 0.99
R0310:Arid4a UTSW 12 71075830 missense probably benign 0.05
R0504:Arid4a UTSW 12 71047214 missense probably damaging 1.00
R1061:Arid4a UTSW 12 71074955 missense probably damaging 1.00
R1087:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1169:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1171:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1531:Arid4a UTSW 12 71076005 missense probably benign 0.01
R1674:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1676:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1768:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1833:Arid4a UTSW 12 71075466 missense possibly damaging 0.50
R1878:Arid4a UTSW 12 71087589 missense probably damaging 1.00
R2290:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2292:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R3411:Arid4a UTSW 12 71061525 splice site probably benign
R3768:Arid4a UTSW 12 71067119 missense probably damaging 1.00
R3838:Arid4a UTSW 12 71075785 missense possibly damaging 0.94
R4320:Arid4a UTSW 12 71069995 missense possibly damaging 0.69
R4589:Arid4a UTSW 12 71069964 missense probably damaging 1.00
R4829:Arid4a UTSW 12 71023498 critical splice acceptor site probably null
R4862:Arid4a UTSW 12 71075947 missense probably damaging 0.96
R4952:Arid4a UTSW 12 71023525 missense possibly damaging 0.64
R5072:Arid4a UTSW 12 71045079 missense probably benign 0.08
R5423:Arid4a UTSW 12 71069860 nonsense probably null
R5767:Arid4a UTSW 12 71060093 missense probably damaging 1.00
R5911:Arid4a UTSW 12 71069973 missense probably damaging 1.00
R5952:Arid4a UTSW 12 71063206 missense probably benign 0.10
R6088:Arid4a UTSW 12 71022236 missense probably damaging 0.99
R6235:Arid4a UTSW 12 71069772 intron probably null
R6277:Arid4a UTSW 12 71039891 missense possibly damaging 0.49
R6455:Arid4a UTSW 12 71075088 missense probably benign 0.04
R6523:Arid4a UTSW 12 71067341 splice site probably null
R6701:Arid4a UTSW 12 71087512 missense probably damaging 1.00
R6812:Arid4a UTSW 12 71047263 missense possibly damaging 0.92
R6815:Arid4a UTSW 12 71017082 splice site probably null
R6858:Arid4a UTSW 12 71023509 missense probably benign 0.01
R6895:Arid4a UTSW 12 71063302 missense probably benign 0.18
R6901:Arid4a UTSW 12 71067137 missense probably damaging 0.99
R6905:Arid4a UTSW 12 71061544 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GCCTGGAGTTTTCTTCACTAGAATG -3'
(R):5'- TGGCAAACCAAGGTTTCAGG -3'

Sequencing Primer
(F):5'- AATCCTGGGACAGCAATC -3'
(R):5'- AAGGTTTCAGGCCCGATCAG -3'
Posted On2018-10-18